Research Article

Horticultural Science and Technology. 31 August 2025. 411-420
https://doi.org/10.7235/HORT.20250037

ABSTRACT


MAIN

  • Introduction

  • Materials and Methods

  •   Test materials

  •   Acquisition of sterile explants of Hongyan and Shengdanhong strawberries

  •   Stem tip stripping and primary culturing

  •   Multiple shoot subculture multiplication culture

  •   Adventitious roots induction

  •   Detection of the detoxification effect of tissue culture seedlings

  • Results and Discussion

  •   Effects of different concentrations of IBA and the 6-BA in strawberry microstem tip culture in vitro

  •   Effects of different hormone combinations and concentrations on buds multiplication culturing

  •   Effects of different combinations and concentrations of plant growth regulators on rooting culture

  •   Virus-free detection of strawberry tissue culture seedlings

  • Conclusions

Introduction

Strawberry is a perennial herb with high nutritional and economic value, and its fruit is delicious and loved by people. The traditional production of strawberry seedlings mostly relies on separate propagation and creeping stem propagation, though the propagation speed is slow and virus infections readily occur, resulting in certain types of degradation, such as quality deterioration, which is not conducive to the promotion and planting of excellent varieties, such that the strawberry industry is encountering bottleneck problems (Hernández-Martínez et al. 2023). At present, the strawberry viruses that are seriously harmful in China mainly include strawberry crinkle virus (SCV), strawberry mottled virus (SMoV), strawberry mild yellow edge virus (SMYEV), and strawberry vein banding virus (SVBV) (Klerks et al. 2004; Wei et al. 2008; Takamura et al. 2020). Micropropagation is the most promising method of plant tissue culturing for the rapid multiplication and conservation of germplasm. Tissue culturing of the strawberry stem tip is the most effective method of maintaining the excellent traits of strawberries at present, having the advantages of a short breeding time, strong plant growth, high yields and excellent quality, all of which effectively improve the quality of seedlings (Yu et al. 2015; Żebrowska 2015; Farjana et al. 2023). The RT-PCR (reverse transcription-polymerase chain reaction) technique can be used for the detection of viruses (Chang et al. 2007; Veetil et al. 2016; Diaz-Lara et al. 2021; Zhao et al. 2022), with the additional advantages of being fast and sensitive.

At present, although there have been many studies of strawberry tissue culturing and rapid propagation systems, there are large differences in the combination and proportion of exogenous plant hormones (Debnath 2009; Sehrawat et al. 2016; Lee et al. 2017; Karmaker et al. 2023), which hinder the practical application of strawberry detoxification and rapid propagation technology and which also require further development. In the present investigation, creeping stem tips of the two genotypes of “Shengdanhong” and “Hongyan” were selected as explants and the most suitable hormone ratios of MS basal medium for the two strawberry varieties were explored by studying these process of shoot-induced culturing, adventitious bud proliferation culturing and rooting culturing, with RT-PCR method used to detect the virus-carrying conditions of strawberry tissue culture seedlings and to obtain virus-free seedlings, all in an effort to establish a strawberry stem-tip tissue cultivation and rapid propagation system. Doing this will provide an important theoretical basis for propagating virus-free strawberry seedlings and proper application methods.

Materials and Methods

Test materials

In this study, two annotinous strawberry varieties of “Hongyan” (originating in Japan) and “Shengdanhong” (originating in Korea) were selected as test materials, and the materials for trial research were cultivated in a greenhouse provided by the strawberry planting base of Agricultural Science and Technology Industrial Park, which is located in Nanyang, China.

Acquisition of sterile explants of Hongyan and Shengdanhong strawberries

Picked and cut shoot tips of the creeping stems of “Hongyan” and “Shengdanhong” about 2 cm in length had the outer bracts removed, the explants of which were then placed in a small beaker, rinsed under a water stream for an hour, soaked in a detergent solution for 20 min, and then rinsed again with running water for 30 min. The cleaned experimental material was placed in a sterile beaker of an appropriate size and sterilized on an ultra-clean bench. First, the specimens were soaked in a 70% alcohol solution for 30 s, rinsed twice with sterile water after removal, and then soaked and disinfected with a 0.1% mercury solution for 10 min. The solution was shaken continuously during this period and finally washed again with sterile water three to five times and set aside.

Stem tip stripping and primary culturing

After the sterilization treatment, asepsis stem tips were peeled off under a stereoscopic anatomical mirror. Young leaves and scale were peeled off layer by layer from the outside to the inside with a dissecting needle, fully exposing the growth points, with stem tip growth point tissue cut to 0.3 - 0.5 mm in size with two leaf primordiums as explants. These were then inoculated on microstem APEX tissue on a MS medium gel consisting of 0.8% (w/v) Phytagel with 30 g·L-1 sucrose added, supplemented with three 6-BA concentrations (0.5 mg·L-1, 1.0 mg·L-1 and 1.5 mg·L-1) and two IBA concentrations (0.1 mg·L-1 and 0.2 mg·L-1). In addition, a CK control was established (Table 1). A total of 560 explants were inoculated to obtain asepsis shoots. The inoculated cultures were grown and maintained at 25 ± 2°C with a 16 h photoperiod under white fluorescent light (3000 lux) and 8 h in the dark in a bioclean room.

Table 1.

Effects of Different Hormone Concentrations on the Callus and Adventitious Bud Induction from Stem Tip of Two Strawberry Genotype Varieties

Strawberry Variety Exogenous hormones Stem tip survival rate
(%)
Callus induction
(%)
Adventitious bud induction rate
(%)
6-BA (mg/L) IBA (mg/L)
Shengdanhong 0 0 80.00 37.50 75.00
0.5 0.1 45.00 37.50 40.00
0.5 0.2 84.21 81.58 84.21
1.0 0.1 83.33 80.56 83.33
1.0 0.2 75.00 65.00 67.50
1.5 0.1 45.00 40.00 45.00
1.5 0.2 5.00 2.50 2.50
Hongyan 0 0 100.00 25.00 85.00
0.5 0.1 86.36 79.55 84.09
0.5 0.2 85.00 77.50 77.50
1.0 0.1 100.00 85.71 88.10
1.0 0.2 90.48 83.33 83.33
1.5 0.1 90.00 82.50 82.50
1.5 0.2 88.89 75.00 75.00

Multiple shoot subculture multiplication culture

An efficient adventitious buds multiplication medium was investigated using MS medium containing cytokinins at various concentrations. Robust tissue culture buds were selected and induced by the primary cultivation of “Hongyan” and “Shengdanhong,” with callus and other browning parts carried by the explants disposed of, with inoculation following on MS medium for multiple shoot regeneration and gelling with 0.8% (w/v) Phytagel and 25 g·L-1 of sucrose added. In total, seven formulation treatments were used for the subculture: 6-BA (0.5 mg·L-1 and 1.0 mg·L-1) and IBA (0.1 mg·L-1 and 0.2 mg·L-1) were added to formulae 1-4, 6-BA (0.2 mg·L-1 and 0.5 mg·L-1) and NAA (0.1 mg·L-1and 0.2 mg·L-1) were added to formulae 5 and 6, and CK was set as a blank control (Table 2). A total of 336 explants were inoculated and maintained at 25 ± 2°C with a 16 h photoperiod under white fluorescent light (3000 lux) with 8 h in the dark in a bioclean room.

Table 2.

Effects of Different Hormones Combinations and Concentrations on the Multiplication of the Adventitious Buds of Two Strawberry Genotype Varieties

Strawberry variety 6-BA (mg/L) IBA (mg/L) NAA (mg/L) Proliferation rate (%) Proliferation coefficients Appearance of performance
Shengdanhong 0 0 0 91.67 1.42 c Plants short, Less bud, Leaf green, A small amount of callus
0.5 0.1 0 100 2.00 bc Plants short, Less bud, Leaf green, A small amount of callus
1.0 0.1 0 91.67 4.00 ab Plants short, Buds many, Leaf green, A large amount of callus
0.5 0.2 0 82.22 3.81 ab Plants tall, more buds, Leaf green, A large amount of callus
1.0 0.2 0 100 5.99 a Plants robust, Buds many, Leaf green, A large amount of callus
0.2 0 0.1 100 6.11 a Plants robust, Bud is more, Leaf green, A large amount of callus
0.5 0 0.2 88.89 3.06 bc Plants robust, Bud is less, Leaf green, A large amount of callus
Hongyan 0 0 0 87.5 1.96 c Plants short, fewer buds, leaves green, small number of calluses
0.5 0.1 0 89.68 3.44 bc Plants short, fewer buds, leaves green, small number of calluses
1.0 0.1 0 83.33 3.33 bc Plants short, buds are more clustered, leaves green, large number of calluses
0.5 0.2 0 100 4.13 bc Plants short, buds are more clustered, leaves green, large number of calluses, vitrification occurring in some plants
1.0 0.2 0 100 5.13 b Plants robust, buds numerous, clumping, leaves green, large number of calluses
0.2 0 0.1 100 7.13 a Plants robust and tall, buds numerous, leaves green, large number of calluses
0.5 0 0.2 85.19 2.99 bc Plants robust, fewer buds, leaves green, large number of calluses

Adventitious roots induction

After the end of the subsequent proliferation culture experiment, robust tissue culture seedlings of “Hongyan” and “Shengdanhong” were selected and inoculated on a 1/2 MS medium gel with 0.8% (w/v) Phytagel and 30 g·L-1 of sucrose added to induced adventitious roots. Medium formulae 1-3 were supplemented with NAA 0.2 mg·L-1, 0.5 mg·L-1 and 1.0 mg·L-1, respectively, and medium formulae 4-6 had IBA 0.2 mg·L-1, 0.5 mg·L-1 and 1.0 mg·L-1 added, respectively, CK served as the blank control (Table 3). Half of each formula media had activated charcoal added (2 g·L-1), with the other parts not treated. A total of 424 explants were inoculated. First, these rootless seedlings cultured were placed in darkness for one week, after which the inoculated cultures were grown and maintained at 25 ± 2°C with a 16 h photoperiod under white fluorescent light (3000 lux), with 8 h in the dark in a bioclean room, as above.

Table 3.

Effects of Different Hormones Combinations and Concentrations on Root Formation of Two Different Strawberry Varieties

Strawberry variety IBA
(mg/L)
NAA
(mg/L)
Rooting percentage (%) Rooting number (bar) Appearance of performance
Sheng danhong 0 0 76.00 5.44 The main lateral root is less obvious, has root hair, and the root is thinner.
0.2 0 76.92 6.82 Plants with more roots and containing AC were tall and robust.
0.5 0 72.41 17.7 Roots slender, many, occasionally callus, obvious primary root
1.0 0 41.94 16 The roots were short and stout, with an obvious callus and primary root.
0 0.2 22.22 15.17 Medium number of roots, and the root callus was abundant.
0 0.5 12.50 11.67 Medium number of roots, short roots, the callus of roots was heavy, and the roots with AC showed browning.
0 1.0 16.00 7.6 The root is strong, there are obvious points of the main lateral root, and there are many long roots.
Hongyan 0 0 87.10 8.92 The roots are long and numerous, the main root is strong, the lateral root is not obvious, and the plant is strong and tall.
0.2 0 87.00 17 The root system is strong and long, showing a callus, and the plants are strong and tall.
0.5 0 91.67 21 There were many roots, and differentiation of the main lateral roots was not obvious.
1.0 0 83.33 25.75 The roots were short and produced more callus, main root differentiation was not obvious.
0 0.2 48.48 14.5 The root callus was severe and the plants were short.
0 0.5 20.00 13.75 The roots was obvious browning and produced more callus, tissue culture seedlings were clumped
0 1.0 3.85 7.71 Many roots, stout, tall plants, roots without a callus

Detection of the detoxification effect of tissue culture seedlings

The RT-PCR procedure was utilized to detect the virus-carrying conditions of the strawberry tissue culture seedlings and to ensure that virus-free seedlings as pre-basic seeds were obtained. Here, 40 test tissue culture seedlings were selected from 14 treatments of “Hongyan” and “Shengdanhong;” three tissue culture seedlings were randomly selected in each treatment. In addition, three annotinous seedlings of “Hongyan” cultivated in an open field were selected as a control group. RNA extraction kits (Plant RNA kit r6827-01 kits) were used to extract total RNA from the leaves of the sample tissue culture seedlings. Detection was conducted with 1% agarose gel electrophoresis and imaging was undertaken with a Bio-Rad gel imaging system. In addition, cDNA was obtained based on total RNA reverse transcription, with the recommended test procedure of the cDNA strand synthesis kit followed.

Two pairs of specific primer sequences of the SMoV and SCV virus types were subjected to PCR amplification, with four strawberry viruses in total synthesized by the Wuhan Qingke Biological Company (Table 4). Using the 3G Taq Master Mix (Red Dye) (Vazyme Biotech Co., Ltd.) containing the Taq enzyme, 43 cDNA specimens obtained by reverse transcription were used as templates for PCR amplification and detection. The RT-PCR reaction system of 20 ul was as follows: 3G Taq Master Mix (Red Dye) at 10 ul, upstream and downstream primers at 1 ul, and cDNA template at 2 ul supplemented with ddH2O a 20 ul. The PCR amplification procedure based on specific primers of the SMoV virus was as follows: pre denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 40 s, extension at 72°C for 30 s, and then extension at 72°C for 5 min, with storage at 4°C. The PCR amplification procedures based on specific primers of the SCV virus used the following steps: pre denaturation at 94ºC for 2 min,followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 56.5°C for 40 s, extension at 72°C for 30 s, and then extension at 72°C for 5 min, with storage at 4°C. PCR amplification products were detected by means of 1.5% agarose gel electrophoresis and were photographed and analyzed using a Bio-Rad gel imaging system.

Table 4.

Specific Primer Sequences of the Four Viruses Used for the Detection Assessments

Viruses Primer sequence
(5’→3’)
Target gene segment
(bp)
SCV CATTGGTGGCAGACCCATCA 345
TTCAGGACCTA TTTGATGACA
SMoV TAAGCGACCACGACTGTGACAAAG 219
TCTTGGGCTTGGATCGTCACCTG

Results and Discussion

Effects of different concentrations of IBA and the 6-BA in strawberry microstem tip culture in vitro

Strawberry stem tip meristems were inoculated into the primary medium and clusters of buds could be distinctly differentiated in 60 days. The data in Table 1 show that when the IBA concentration was quantitative, the survival rate of stem tips and the induction rate of adventible buds showed a trend of initially increasing and then decreasing with an increase in the 6-BA concentration. When the concentration of 6-BA remained constant, the survival rate of stem tips and the induction rate of adventible buds decreased with an increase in the IBA concentration. For the MS medium supplemented with 0.5 mg·L-1 6-BA and 0.2 mg·L-1 IBA, the stem tip survival rate, callus induction rate and shoot induction rate of ‘Shengdanhong’ reached 84.21%, 81.58% and 84.21%, respectively (Fig. 1A and 1B). For the MS medium supplemented with 1.0 mg·L-1 6-BA and 0.1 mg·L-1 IBA, the stem tip survival rate, callus induction rate and adventitious bud induction rate of ‘Hongyan’ reached 100%, 85.71% and 88.10%, respectively (Fig. 1C and 1D). It can be seen that the hormone concentrations required for the ex vivo culturing of strawberries of different genotypes are different.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-04/N020250037/images/HST_20250037_F1.jpg
Fig. 1.

Shoot induction from the micro-stem tip of ‘Shengdanhong’ and ‘Hongyan’ strawberries on the medium component of the stem tip primary culture for 60 days: A, B) Initiation and regeneration of the maximum frequency of the ‘Shengdanhong’ strawberry multiple shoot culture in the 6-BA medium (0.5 mg/L) and the IBA (0.2 mg/L) medium. C, D) Initiation and regeneration of the maximum frequency of the ‘Hongyan’ strawberry multiple shoot culture in the 6-BA medium (1.0 mg/L) and the IBA (0.1 mg/L) medium. Scale bar = 1.0 cm.

Effects of different hormone combinations and concentrations on buds multiplication culturing

An analysis of the data in Table 2 shows that the adventitious bud proliferation coefficient of the ‘Shengdanhong’ and ‘Hongyan’ strawberry tissue culture seedlings in the MS induction culture medium component containing different hormone combinations and concentrations of subculture multiplication culture have significant differences. Figure 2 (A1, B1, C1, D1) shows different effects of the adventitious bud propagation of Strawberry ‘Shengdanhong’ and ‘Hongyan’ on the medium component of the different hormones combination and concentrations used for the subculture multiplication culture over a period of 40 days. When the concentration of 6-BA was 0.5 or 1.0 mg·L-1, the adventitious bud proliferation coefficients of both strawberry ‘Shengdanhong’ and ‘Hongyan’ types increased with an increase in the IBA concentration. When the IBA concentration was 0.1 or 0.2 mg·L-1, the adventitious bud proliferation coefficient of Poinsettia increased with an increase in the 6-BA concentration. A comprehensive analysis revealed that the maximum proliferation coefficient was achieved with the MS medium containing 0.2 mg·L-1 6-BA and 0.1 mg·L-1 NAA among these different medium treatments; the proliferation coefficient of “Shengdanhong” was 6.11, and the proliferation coefficient of “Hongyan” was 7.13, with strong seedlings with an abundant callus. This medium treatment was considered as the optimization medium for bud subculture multiplication.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-04/N020250037/images/HST_20250037_F2.jpg
Fig. 2.

Adventitious bud propagation of Strawberry ‘Shengdanhong’ and ‘Hongyan’ strawberries on the medium component of the subculture multiplication culture for 40 days. A1. Adventitious bud propagation of ‘Shengdanhong’ strawberries in the 6-BA medium (0.5 mg/L) and IBA (0.1 mg/L) medium; B1. Adventitious bud propagation of ‘Shengdanhong’ strawberries in the 6-BA medium (0.5 mg/L) and NAA (0.2 mg/L) medium; C1. Adventitious bud propagation of ‘Hongyan’ strawberries in the CK medium; D1. Adventitious bud propagation of ‘Hongyan’ strawberries in the 6-BA medium (0.2 mg/L) and NAA (0.1 mg/L) medium. Scale bar = 1.0 cm.

Effects of different combinations and concentrations of plant growth regulators on rooting culture

The optimal rooting induction culture medium formula was the 1/2 MS induction culture medium supplemented with 0.5 mg·L-1 IBA,30 g·L-1 sucrose and 7 g·L-1 agar. Using the 1/2 MS medium as the basic medium, healthy rootless strawberry seedlings were inoculated into the rooting medium with different hormone concentrations to observe the rooting condition. The datasets in Table 3 show that for the “Shengdanhong” variety with the 1/2 MS medium supplemented with 0.5 mg·L-1 IBA, the rooting rate was 72.41%, the average root number was 17.7 at most, and the plant was tall and robust. For the “Hongyan” variety, with 0.5 mg·L-1 IBA added to the 1/2 MS medium, the highest rooting rate was 91.67%, the average root number was 21, the root system was strong, the plants were strong and tall, and the callus appeared.

Virus-free detection of strawberry tissue culture seedlings

Total RNA from the leaves of 40 strawberry tissue culture seedlings was isolated and detected, with the 18S and 28S bands relatively complete and clear, possibly meeting the quality requirements for reverse transcription (Fig. 3). The virus-free rates of the stem tip cultured in-vitro seedling samples of the two strawberry varieties were ascertained and assessed by primer screening, PCR amplification, and 1.5% agarose gel electrophoresis (Figs. 4 and 5). Among the 40 stem tip cultured sample,the number of plants carrying the SMoV virus amounted to three, and the number of virus-free seedlings came to 37, indicating a virus-free rate of 92.5%. None of the strawberry stem tip tissue culture seedlings carried SCV, and the number of tissue culture seedlings without SCV was 40, for a virus-free rate of 100%. Comprehensive research presents that the virus-free rate examined by RT-PCR of the tissue culture seedlings in vitro cultivated was 92.5%, demonstrating that tissue culture seedlings micro-propagated from creeping stem tips were expeditious and reliable for the breeding of virus-free seedlings.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-04/N020250037/images/HST_20250037_F3.jpg
Fig. 3.

Total RNA from the leaves of 40 strawberry tissue culture seedlings were isolated and detected with 1% agarose gel electrophoresis. Lane M: Trans2K Plus Ⅱ DNA Marker. Lanes 1-40: in-vitro regenerated seedlings. Lanes 41- 43 are cultivated plants.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-04/N020250037/images/HST_20250037_F4.jpg
Fig. 4.

Results of 1% agarose gel electrophoresis detection of ‘Shengdanhong’ and ‘Hongyan’ strawberries for the SMoV virus by RT-PCR. Lane M: Trans2K Plus Ⅱ DNA Marker. Lane 1-40: PCR amplification product detection of in-vitro regenerated seedlings; 41-43 show the PCR amplification product detection outcomes of cultivated plants. Downward indicating arrows denote the amplified positive DNA band of RT-PCR samples 22, 24, 40, 41, 42, and 44 in their corresponding lanes.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-04/N020250037/images/HST_20250037_F5.jpg
Fig. 5.

Results of 1% agarose gel electrophoresis detection of ‘Shengdanhong’ and ‘Hongyan’ strawberries for the SCV virus by RT-PCR.Lane M: Trans2K Plus Ⅱ DNA Marker. Lane1-40: PCR amplification product detection of in-vitro regenerated seedlings. 41-43 show the PCR amplification product detection outcomes of cultivated plants.

Conclusions

In the primary medium, an appropriate plant growth regulator such as 6-BA combined with IBA was beneficial for the induction of explants (Cappelletti et al. 2016; Rimy et al. 2024). The present study investigated the effects of different concentrations and combinations of plant growth regulators on the in vitro regeneration process of strawberries. The results showed that with the treatment of an induction culture MS medium containing the best combination of 0.5 mg·L-1 6-BA and 0.2 mg·L-1 IBA, the shoot tip survival rate, callus induction rate and adventitious shoot induction rate of “Shengdanhong” were found to be 84.21%, 81.58% and 84.21%, respectively. Under the induction culture of MS basal media containing the best combination of 1.0 mg·L-1 6-BA and 0.1 mg·L-1 IBA, the shoot tip survival rate, callus induction rate and adventitial shoot induction rate of “Hongyan” were 100%, 85.71% and 88.10%, respectively. It was therefore confirmed that explants of different varieties require different types and concentrations of optimal growth regulators (Wang et al. 2015; Naing et al. 2019). In the adventitious bud proliferation culture, the results found by a comparison of three hormones at different concentrations showed that adding 0.2 mg·L-1 6-BA and 0.1 mg·L-1 NAA led to the best proliferation coefficients of “Shengdanhong” and “Hongyan,” at 6.11 and 7.13, respectively. The increment coefficients of “Hongyan” were significantly different from those of other formulations (p < 0.5). Through rooting culture assessments, it was found that rooting induction was straightforward for strawberry seedlings, as a large number of roots could be induced in a medium without a plant growth regulator. The rooting effect of IBA was better than that of NAA. When the concentration of IBA was 0.5 mg·L-1, the rooting rates of “Shengdanhong” and “Hongyan” were phenomenal and efficient (72.41% and 91.67%, respectively), and the average root number was the highest (17.7 and 21, respectively). In addition, it was found that adding 2 g·L-1 AC could effectively prevent browning of the plants; in addition, the roots of the plants were stronger, the leaf color was dark green, and growth was robust. In this study, two strawberry viruses, SMoV and SCV, were successfully detected by the RT-PCR method, with virus-free rates up to 92.5%. In order to ensure the reliability and feasibility of a negative control, an internal standard can be introduced to further address this issue. Therefore, it is of great significance to use the virus-free technology related to in-vitro shoot tip culturing to establish a rapid propagation system for strawberries, to breed strawberry pre-basic seed seedlings, to improve the quality and yields of strawberries, and promote the industrialization of these fruit (Chen et al. 2019).

Acknowledgements

This research was funded by the “Henan Province Foundation for Science and Technology Development Plan” in 2023 under Grant number 232102310336, by the “Key Scientific Research Project Plan of Colleges and Universities of Henan Province” under Grant number 22B180009, and by the “Nanyang Normal University Talent Introduction Special Scientific Research Fund Project” under GRANT number 2018ZX005 of China.

Author Contributions

Guoye Guo designed the research project; Wenxue Li performed the research; Yichen Liu, Xiaoyi Jing, Manyu Su, Yuxuan Ding and Jiaying Wu assisted in observing and recording data. Guoye Guo and Wenxue Li analyzed the data and co-wrote the article. All authors read and approved the manuscript.

References

1

Cappelletti R, Sabbadini S, Mezzetti B (2016) The use of TDZ for the efficient in vitro regeneration and organogenesis of strawberry and blueberry cultivars. Sci Hortic 207:117-124. https://doi.org/10.1016/j.scienta.2016.05.016

10.1016/j.scienta.2016.05.016
2

Chang L, Zhang Z, Yang H, Li H, Dai H (2007) Detection of strawberry RNA and DNA viruses by RT-PCR using total nucleic acid as a template. J Phytopathol 155:431-436. https://doi.org/10.1111/j.1439-0434.2007.01254.x

10.1111/j.1439-0434.2007.01254.x
3

Chen L, Wang MR, Li JW, Feng CH, Cui ZH, Zhao L, Wang QC (2019) Exogenous application of melatonin improves eradication of apple stem grooving virus from the infected in vitro shoots by shoot tip culture. Plant Pathol 68:997-1006. https://doi.org/10.1111/ppa.13018

10.1111/ppa.13018
4

Debnath SC (2009) Characteristics of strawberry plants propagated by in vitro bioreactor culture and ex vitro propagation method. Eng Life SCI 9:239-246. https://doi.org/10.1002/elsc.200800095

10.1002/elsc.200800095
5

Diaz-Lara A, Stevens KA, Klaassen V, Hwang MS, Al Rwahnih M (2021) Sequencing a strawberry germplasm collection reveals new viral genetic diversity and the basis for new RT-qPCR assays. Viruses 13:1442. https://doi.org/10.3390/v13081442

10.3390/v1308144234452308PMC8402890
6

Farjana S, Park IS, Choi JM (2023) Impact of controlled nitrogen application in water solution on seedling growth, tissue and soil nutrient concentrations in vegetative propagation of strawberry. Hortic Environ Biote 64:41-50. https://doi.org/10.1007/s13580-022-00460-4

10.1007/s13580-022-00460-4
7

Hernández-Martínez NR., Blanchard C, Wells D, Salazar-Gutiérrez MR (2023) Current state and future perspectives of commercial strawberry production: A review. Sci Hortic 312:111893. https://doi.org/10.1016/j.scienta.2023.111893

10.1016/j.scienta.2023.111893
8

Karmaker S, Hossain MM, Hoque MA, Kaium MA, Ali TB, Ferdous M (2023) In Vitro Propagation of Three Strawberry Varieties and Field Evaluation. Am J Plant Sci 14:1214-1222. https://doi.org/10.4236/ajps.2023.1411082

10.4236/ajps.2023.1411082
9

Klerks MM, Lindner JL, Vaškova D, Špak J, Thompson JR, Jelkmann W, Schoen CD (2004) Detection and tentative grouping of Strawberry crinkle virus isolates. Eur J Plant Pathol 110:45-52. https://doi.org/10.1023/B:EJPP.0000010134.06283.38

10.1023/B:EJPP.0000010134.06283.38
10

Lee HS, Cheung JD, Choi JM (2017) Lowered Substrate pH Reduced the Bicarbonate Injury during Vegetative Growth of 'Ssanta' Strawberry. J Bio-Env Con 26:115-122. https://doi.org/10.12791/KSBEC.2017.26.2.115

10.12791/KSBEC.2017.26.2.115
11

Naing AH, Kim SH, Chung MY, Park SK, Kim CK (2019) In vitro propagation method for production of morphologically and genetically stable plants of different strawberry cultivars. Plant Methods 15:1-10. https://doi.org/10.1186/s13007-019-0421-0

10.1186/s13007-019-0421-031011361PMC6461810
12

Rimy FA, Karmakar B, Haque MS, Yasmin S, Khatun F (2024) Effect of Plant Growth Regulators on Mass Propagation of Strawberry (Fragaria sp.): Mass production of strawberry plantlets in vitro. JBAU 22:178-184. https://doi.org/10.3329/jbau.v22i2.74576

10.3329/jbau.v22i2.74576
13

Sehrawat SK, Poonia AK, Kajla S, Bhat S (2016) Production of strawberry plant by in vitro propagation. Res Crop 17:545-549. https://doi.org/10.5958/2348-7542.2016.00091.7

10.5958/2348-7542.2016.00091.7
14

Takamura Y, Yamaryo S, Wang WQ, Neriya Y, Suzuki E, Namai K, Ali A, Nishigawa H, Natsuaki T (2020) First report of the complete genomic sequences of strawberry mild yellow edge virus and strawberry vein banding virus isolated in Japan. J Gen Plant Pathol 86:503-506. https://doi.org/10.1007/s10327-020-00947-x

10.1007/s10327-020-00947-x
15

Veetil TT, Ho T, Moyer C, Whitaker VM, Tzanetakis IE (2016) Detection of Strawberry necrotic shock virus using conventional and TaqMan® quantitative RT-PCR. J Virol Methods 235:176-181. https://doi.org/10.1016/j.jviromet.2016.06.005

10.1016/j.jviromet.2016.06.00527283883
16

Wang H, Li M, Yang Y, Dong J, Jin W (2015) Histological and endogenous plant growth regulators changes associated with adventitious shoot regeneration from in vitro leaf explants of strawberry (Fragaria × ananassa cv. 'Honeoye'). Plant Cell Tiss Org 123:479-488. https://doi.org/10.1007/s11240-015-0851-y

10.1007/s11240-015-0851-y
17

Wei T, Lu G, Clover G (2008) Novel approaches to mitigate primer interaction and eliminate inhibitors in multiplex PCR, demonstrated using an assay for detection of three strawberry viruses. J Virol Methods 151:132-139. https://doi.org/10.1016/j.jviromet.2008.03.003

10.1016/j.jviromet.2008.03.00318453003
18

Yu J, Wang M, Dong C, Xie B, Liu G, Fu Y, Liu H (2015) Analysis and evaluation of strawberry growth, photosynthetic characteristics, biomass yield and quality in an artificial closed ecosystem. Sci Hortic 195:188-194. https://doi.org/10.1016/j.scienta.2015.09.009

10.1016/j.scienta.2015.09.009
19

Żebrowska JI. (2015) Effect of quantitative plant traits on the efficiency of in vitro cloning of strawberry (Fragaria × ananassa Duch.). J Hortic Sci Biotechnol 90:407-412. https://doi.org/10.1080/14620316.2015.11513202

10.1080/14620316.2015.11513202
20

Zhao X, He C, Gao D, Xu T, Li X, Liu J, Li S, Wang H (2022) Construction of Infectious cDNA Clone of Brassica Yellows Virus Isolated from Strawberry and Establishment of TaqMan RT-qPCR. Plants 11:3380. https://doi.org/10.3390/plants11233380

10.3390/plants1123338036501425PMC9735513
페이지 상단으로 이동하기