Research Article

Horticultural Science and Technology. 30 June 2025. 399-409
https://doi.org/10.7235/HORT.20250042

ABSTRACT


MAIN

  • 서 언

  • 재료 및 방법

  •   시료

  •   추출물 제조

  •   Total phenolic compounds(TPC) 함량 측정 및 세포 적용 농도 조절

  •   세포 배양

  •   Macrophage cell line MTT assay

  •   Nitric oxide(NO) 생성저해 측정

  •   Western blot을 이용한 iNOS, COX(cyclooxygenase)-2 protein 발현량 측정

  •   Real-time PCR을 이용한 pro-inflammatory cytokine(TNFα, IL1β, IL6, MCP1, PTGES2) mRNA 발현량 측정

  •   통계처리

  • 결과 및 고찰

  •   말오줌나무잎 phenolic의 macrophage cell line에 대한 MTT assay

  •   Macrophage cell line에서 말오줌나무잎 phenolics에 의한 NO 생성량 억제

  •   Western blot을 이용한 iNOS, COX-2 protein 발현량 억제

  •   Real-time PCR을 이용한 pro-inflammatory cytokine(TNFα, IL1β, IL6, MCP1, PTGES2) mRNA 발현 억제 측정

서 언

최근 환경호르몬, 화학물질, 배기가스 등에 의해 생활환경이 오염되고, 근교 농업 중 원예작물들의 오염이 심해짐에 따라 건강한 식탁에 오를 수 있는 친환경적인 원예작물의 요구가 높아지고 있는 현실이다. 또한 생활수준이 높아짐에 따라 높은 값을 치르더라도 건강을 담보할 수 있는 친환경 또는 기능성 원예작물의 선호도가 높아지고 있다. 이와 관련하여 쉽게 채취할 수 있는 식물체 혹은 원예작물로부터 생리활성 기능을 밝혀내고 이를 건강기능식품에 적용하고자 하는 시도가 다양하게 진행되어 왔으며, 약리성을 가진 새로운 자원을 찾는 연구가 각광받고 있다(Choi and Yang 2008). 2010년 생물다양성에 대하여 국자적인 협약을 진행한 나고야의정서에 따라 우리나라의 자생식물에 대한 정보도 공유되고 있으며, 미발굴된 유용성 자생식물 및 원예자원 등을 찾아내어 생리활성을 규명한 후 healthy 제품 및 의약품으로서의 기능성을 탐색하고 있다(Kim and Kim 1999; Lee et al. 2005; Han 2010; Chung et al. 2010; Seo et al. 2011; Im et al. 2011; Jeong et al. 2012). 특히 야생초나 산채류의 식물에는 각종 폴리페놀류, 배당체, 플라보노이드류 등이 함유되어 있어서 생리학적 효과가 우수하며 건강한 먹거리를 위한 원예작물로 개발할 수 있는 가능성이 매우 높다(Chung et al. 2011; Kim et al. 2012).

식물에 다량 존재하는 폴리페놀화합물은 항산화 효과를 비롯하여 피부노화, 염증, 암 등에 대한 억제 효과와 예방 효과가 알려져 있다(Yun et al. 2007; Wang et al. 2021; Yu et al. 2021; Mignard et al. 2021; Wina et al. 2021). 상기의 질병들은 세포단위에서 산화에 의해 생성된 ROS가 스트레스를 유발하고, 항산화 시스템을 손상시켜 피부의 노화가 촉진되며, 염증, 피부질환, 암, 혈관질환 등 다양한 질병의 원인이 되기도 하며(Halliwell and Gutteridge 1992; Valko et al. 2007), 피부에서는 염증반응이 일어날 수 있다. 이러한 다양한 질병의 예방에는 식물에 존재하는 폴리페놀화합물이 효율적으로 적용될 수 있는 것으로 보고되고 있다(Moncada et al. 1991; McCartney-Francis et al. 1993; Kim et al. 2004b). 대표적인 염증 관여 효소인 iNOS, COX-2와 염증반응을 매개하는 tumor growth factor-α(TNF-α), interleukin-6(IL-6) 및 IL-1β 등 다양한 염증성 인자들은 또한 폴리페놀화합물에 의해 억제효과를 나타내는 것으로 보고되어 있다(Claude et al. 1999; Surh 2002; Li and Verma 2002; Kim et al. 2004a; Kim et al. 2007; Kim et al. 2011; Kim et al. 2013; Xu et al. 2020).

말오줌나무(Sambucus sieboldiana var. pendula)는 경상북도 울릉도 자생식물로 오직 울릉도에서만 산비탈이나 넓은 개활지에서 자생하는 낙엽활엽수 관목으로 꽃은 6월에 피고, 열매는 7월에 익는다(Lee 2014). 딱총나무 속 식물에 속하는 말오줌나무는 우리나라에서는 뼈에 좋은 약재로 인식되어 ‘접골목’으로 불리는 한약재이며, 한방에서는 이뇨약으로 사용되고 있다(Lee 1966; Park 1993; Park et al. 2006). 또한 말오줌나무는 약재로서의 용도뿐만 아니라, 순과 잎을 식용할 수 있는 식품원료로 식약청에 고지되어 있다. 최근 말오줌나무에 대한 기능성연구로는 항산화(Chae and Cho 2012), 류마티스 관절염(Lee et al. 2012), 골다공증(Yoo and Jeong 2000), 간세포 보호 효과(Kim 2013) 등이 연구된 바 있다. 말오줌나무에 대한 생리활성을 검토한 연구는 있으나(Kim et al. 2013), 항염증효과를 세포 수준에서 연구한 결과는 발표된 바가 없다.

따라서 본 연구에서는 울릉도 자생식물인 말오줌나무잎으로부터 폴리페놀화합물을 분리하여 항염증효과를 세포 수준에서 규명하여 기능성 소재로 활용할 수 있음을 규명하고, 자생색물인 말오줌나무를 인위적인 재배를 통한 원예작물로 활용하기 위한 목표를 가지고 산업화를 위한 자료로 활용하고자 하였다.

재료 및 방법

시료

울릉도에서 자생하는 말오줌나무잎은 울릉도에서 채취하여 경북대학교 소재 울릉도·독도 연구소에서 보관하고 있는 식물정보를 이용하여 형태적 특징으로 동정하였으며(Park et al. 2022), 잎을 수거하여, 45°C dry oven에서 건조하고 100mesh로 분쇄하여 ‒60°C 냉동고에 보관하였다.

추출물 제조

생리활성 검정을 위한 시료는 열수추출물의 경우 말오줌나무잎 분말시료 1g을 DW 200mL에 분산시키고, 가열하여 100mL로 농축한 후 냉각 후, 상온에서 하루 동안 교반, 추출하였다. 에탄올 추출물은 말오줌나무잎 분말 1g을 50%의 에탄올 100mL에 분산시키고 하루 동안 교반, 추출하였으며, 추출액은 Whatman No. 1 paper로 여과하고 회전 증발기(Eyela NE, Tokyo, Japan)로 농축한 후 ‒80°C에서 동결건조하여 시료로 사용하였다.

Total phenolic compounds(TPC) 함량 측정 및 세포 적용 농도 조절

추출물에 함유된 total phenolics 함량은 Folin과 Denis의 방법(1912)에 준하여 측정하였으며, 표준곡선(gallic acid)를 이용하여 환산하였다. 세포실험에 사용된 시료는 crude extract의 phenolics 양을 측정하여 25–75µg의 phenolic 농도에 해당하는 추출물양을 세포에 적용하였다.

세포 배양

실험에 사용한 대식세포(Raw 264.7cell)은 한국세포주은행으로부터 구매하였다. 세포 배양은 DMEM(HyClone Laboratories, Inc.)에 10% FBS, 1% penicillin-streptomycin을 혼합한 배양액에서 37°C, 5% CO2 incubator 조건으로 배양하였다. 실험에 사용한 세포는 20 passages를 넘기지 않은 활력이 우수한 세포를 사용하였다(Lee 2011).

Macrophage cell line MTT assay

말오줌나무 잎 추출물 자체의 세포독성을 평가하기 위해 Carmichael et al.(1987)의 방법에 준하여 세포생존율을 측정하였다. Raw 264.7 세포(5×103cells/mL)에 시료를 25–75µg/mL phenolics 농도로 첨가하여 18시간 동안 배양하였다. 배양액에 5mg/mL MTT 시약을 50µL를 첨가하고, 4시간 2차 배양한 후 배양액을 제거하였다. DMSO 500µL를 가하여 실온에서 10분간 반응시킨 뒤 540nm에서 ELISA reader(SPECTRO star Nano, BMG LABTECH.)로 흡광도를 측정하였다. Cell viability (%)는 시료 흡광도/대조구 흡광도 × 100으로 나타내었다.

Nitric oxide(NO) 생성저해 측정

LPS 자극된 세포에서 염증발생에 관여하는 효소인 induced nitric oxide synthase(iNOS)에 의해 유발되는 NO의 생성에 미치는 말오줌나무 잎 phenolics의 영향을 알아보기 위해 세포배양액에서 NO 생성은 세포배양액의 NO2‒ 함량을 측정하였다(Ryu et al. 2003; Cho and An 2008). Raw 세포를 5×104cells/mL 농도로 plate(96well)에 분주하고, 1µg/mL의 LPS와 말오줌나무 잎 phenolic을 25–75µg/mL의 농도로 처리하여 5% CO2 incubator에서 18시간 배양하였다. NO 생성량은 supernatant를 모아 Griess reagent system’s kit 시약으로 반응시킨 후 ELISA reader(SPECTRO star Nano, BMG LABTECH.)를 이용하여 540nm에서 흡광도를 측정하였다. 세포배양액 내 NO의 농도는 0.1M sodium nitrite(NaNO2)를 이용한 표준곡선에 의해 NO 생성저해율(%)은 (1–시료 흡광도/대조구 흡광도) ×100으로 나타내었다.

Western blot을 이용한 iNOS, COX(cyclooxygenase)-2 protein 발현량 측정

LPS로 자극에 의해 염증이 유발된 Raw 세포에서 염증유발 효소인 iNOS, COX-2 protein 발현량에 미치는 말오줌나무 잎 phenolics의 영향을 알아보기 위해 세포를 plate(6well)에 5×105cells/mL 농도로 분주하고 1µg/mL의 LPS와 말오줌나무 잎 phenolics을 25–75µg/mL의 농도로 처리하여 5% CO2 incubator에서 18시간 배양하고 PBS로 세척하였다. M-PER와 protease inhibitor를 섞은 mixture를 70µL/well 첨가하여 4°C에서 lysis시킨 후, 20분간 원심분리(4°C, 16,000xg)하여 세포막 성분 등을 제거하였다.

원심분리 후 상징액을 BCA kit(Thermo Fisher Scientific.)로 단백질 정량하였으며, 30µL의 세포단백질을 10%의 SDS-polyacrylamide gel을 이용하여 100 volt로 1시간 30분 동안 전기 영동하였다. 분리된 단백질 gel은 transfer cell기기(Hofer, Holliston, MA, USA)를 이용하여 polyvinylidenefluoride membrane(Millipore Corp, Bedford, MA, USA)으로 60 volt로 2시간 30분간 transfer한 후 실온에서 1시간 동안 5% skim milk 용액으로 blocking하였다. Blocking이 끝난 membrane에 1차 antibody(iNOS, COX-2, β-actin)를 4°C에서 over night 동안 적용시켰으며, TBST buffer를 이용하여 3회 세척하였다. 2차 antibody(Mouse anti-rabbit lgG-HRP, goat anti-mouse IgG)를 1시간 동안 반응시킨 후 TBST buffer를 이용하여 3회 세척하였으며, enhanced chemiluminescence(ECL) kit(Millipore Corp.)와 반응시켜 Azure Biosystems(C300, Azure Biosystems inc.)를 이용하여 band를 발현시키고 정량하였다(Cho 2011).

Real-time PCR을 이용한 pro-inflammatory cytokine(TNFα, IL1β, IL6, MCP1, PTGES2) mRNA 발현량 측정

LPS로 자극된 Raw 세포의 pro-inflammatory cytokine mRNA 발현량 측정은 세포를 culture dish(100×20mm)에 5×106 cells/mL의 농도로 분주하고 1µg/mL의 LPS와 말오줌나무 잎 phenolics을 25–75µg/mL의 농도로 처리하여 5% CO2 incubator에서 18시간 배양하고 PBS로 세척하였다. 염증성 cytokine의 mRNA를 분석하기 위하여 total RNA는 GeneAll® Ribospin RNA extraction kit(GeneAll Biotechnology Co.)로 추출하였다. 추출한 total RNA는 -80°C에 보관하였으며, qPCRBIO cDNA synthesis Kit(PCR Biosystems.)로 cDNA를 합성하였다. 합성된 cDNA는 Tris/EDTA buffer를 이용하여 1/2로 희석하였다. RT-PCR 분석은 1µL의 합성된 cDNA, 5µL의 Real time PCR master mix(GeneAll Biotechnology Co.), 그리고 primer 및 nuclease-free water를 넣고 PCRmax Eco 48 real-time PCR system으로 유전자별 mRNA 발현을 실시간 분석하였다. Table 1에는 PCR operating 조건을 Table 2에는 primer sequence를 나타내었다.

Table 1.

Primer Sequences used in real-time PCR

Factors Accession Primer Sequence (5' -3') Amplicon (bp)
TNFα NM_001278601.1 F
R
TCTACTGAACTTCGGGGTGA
AGGGTCTGGGCCATAGAACT
87
IL1β NM_008361.4 F
R
CAACCAACAAGTGATATTCTCCATG
GATCCACACTCTCCAGCTGCA
152
IL6 NM_031168.2 F
R
TAGTCCTTCCTACCCCAATTTCC
TTGGTCCTTAGCCACTCCTTC
76
MCP1 NM_011333.3 F
R
TTCCTCCACCACCATGCAG
CCAGCCGGCAACTGTGA
64
PTGES2 NM_133783.2 F
R
CCGTGAGAAGGACTGAGATC
AAGTGATGACCTCTTCCAGG
162
β-actin NM_007393.4 F
R
CGTGCGTGACATCAAAGAGAA
GCTCGTTGCCAATAGTGATGA
137

F: forward, R: reverse.

Table 2.

Real-Time PCR conditions

Factors RT-PCR condition
TNFα, IL1β
MCP1, PTGES2, β-actin
95°C for 5 min; followed by 40 cycles at 95°C for 10 s ,and 60°C for 20 s; 95°C for 15 s, 55°C for 15 s, and 95°C for 15 s
IL6 95°C for 5 min; followed by 40 cycles at 95°C for 10 s, 60°C for 20 s, and 72°C for 15 s; 95°C for 15 s, 55°C for 15 s, and 95°C for 15 s

통계처리

모든 자료의 수치는 평균 ± 표준편차로 표시하였고, 통계처리는 GraphPad Prism ver. 10.3.1.(GraphPad Software, Inc., San Diego, CA, USA).을 이용하여 Tukey’s multiple comparison test one-way ANOVA를 실시하여 유의차를 p < 0.05 수준으로 분석하였다.

결과 및 고찰

말오줌나무잎 phenolic의 macrophage cell line에 대한 MTT assay

말오줌나무잎 phenolic의 세포 독성을 확인하기 위해 MTT assay로 세포 생존율을 측정한 결과는 Fig. 1에서와 같다. 말오줌나무잎 phenolics을 25–100µg/mL로 처리하였을 때 100µg/mL의 농도에서 세포 생존율이 물 추출물(A)과 에탄올 추출물(B)에서 각각 75.79%, 68.13%로 감소하는 것을 확인하였다. 따라서 본 연구에서는 말오줌나무잎 phenolics을 처리하였을 때 세포 생존율에 크게 영향을 미치지 않는다고 판단되는 80% 이상의 높은 세포 생존율을 가지는 75µg/mL 이하의 농도로 설정하여 추후 NO 생성량, western blot 및 real-time PCR로 cytokine 측정 실험을 진행하였다.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-03/N020250042/images/HST_20250042_F1.jpg
Fig. 1.

Cell viability of the water extract (A) and ethanol extract (B) of Sambucus sieboldiana leaves in raw 264.7 cells. Raw cells (5×103 cells/mL) were treated with Sambucus sieboldiana phenolics from the water extract (A) or ethanol extract (B) and incubated for 18 h before determining cytotoxicity by means of a MTT assay. Data are presented as the mean ± SD (n=9). Means with different letters are significant (p < 0.05).

Macrophage cell line에서 말오줌나무잎 phenolics에 의한 NO 생성량 억제

말오줌나무잎 phenolics가 NO 생성량에 미치는 영향을 확인하기 위해 LPS 자극한 Raw cell에 LPS 1µg/mL와 말오줌나무잎 phenolics을 25–75µg/mL의 농도로 처리하여 측정한 결과 Fig. 2에서와 같이 물 추출물(A)과 에탄올 추출물(B)에서 75µg/mL의 농도에서 각각 63.8%와 50.2%의 NO 생성량을 나타내어 control(100%)에 비해 NO 생성이 억제되는 것을 확인하였다. 또한 물추출물에 비해 에탄올 추출물에서 상대적으로 낮은 NO 생성율을 나타내었으며, NO 억제 효과는 농도 의존적으로 유의적으로 감소하였다.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-03/N020250042/images/HST_20250042_F2.jpg
Fig. 2.

Phenolic compounds from Sambucus sieboldiana reduced NO production. LPS-stimulated raw 264.7 cells were treated Sambucus sieboldiana water extract (A) or ethanol extract (B) for 18 h. Data are presented as the mean ± SD (n=3). Means with different letters are significant (p < 0.05).

위의 결과에 따라 말오줌나무잎 phenolic 물질은 세포신호전달에 중요한 역할을 하는 NO 억제에 효과가 있음이 확인되었고, NO 생성억제로 인해 염증 반응을 억제할 수 있을 것으로 예상되었다. 또한 말오줌나무잎 phenolic 물질은 NO 생성에 촉매 역할을 하는 iNOS protein의 expression에도 영향을 미칠 것으로 추정되어 iNOS protein expression을 확인하였다.

Western blot을 이용한 iNOS, COX-2 protein 발현량 억제

염증 유발인자인 NO를 생성하는 iNOS protein과 염증성 cytokine 종류인 prostagrandin E2를 생성하는 COX-2 protein의 발현에 미치는 말오줌나무잎 phenolics의 영향을 살펴보기 위하여 LPS 자극된 Raw cell에 말오줌나무잎 phenolic을 25–75µg/mL 농도로 처리하여 protein 발현량을 측정하였다. Fig. 3에서와 같이 iNOS protein 발현양은 75µg/mL phenolics 농도에서 물 추출물(A)과 에탄올 추출물(B)이 각각 55.06%와 21.27%의 iNOS protein 발현량을 나타내어 높은 iNOS 억제효과를 확인하였다. COX-2의 경우에는 75µg/mL phenolics 농도에서 물 추출물(C)과 에탄올 추출물(D)이 각각 20.19%와 41.42%의 COX-2 protein 발현량을 나타내어 높은 COX-2 protein 발현 억제효과를 확인하였다. 상기의 결과와 같이 LPS에 의해 자극된 Raw cell에서 말오줌나무잎 phenolic에 의해 iNOS, COX-2 protein 모두 농도 의존적으로 발현량이 감소하는 것을 확인하였다.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-03/N020250042/images/HST_20250042_F3.jpg
Fig. 3.

Sambucus sieboldiana phenolics reduced the expression levels of iNOS and COX-2. Raw 264.7 cells were stimulated with LPS and treated with Sambucus sieboldiana phenolics at a concentration range of 25-75 μg/mL and were then incubated for 18 h. iNOS expression was inhibited with both the water extract (A) and ethanol extract (B). COX-2 expression was inhibited with both the water extract (C) and ethanol extract as well (D). Data are presented as the mean ± SD (n=3). Means with different letters are significant (p < 0.05).

위의 결과에 따라 말오줌나무잎 phenolic이 NF-κB의 신호전달에 의해 인산화되어 발현이 조절되는 iNOS, COX-2 protein의 발현억제가 확인되었으며, 또한 iNOS의 억제 양상은 앞선 NO 생성 억제와 유사한 결과를 나타내었으며, COX-2에 의해 매개되는 PGE2 또는 PTGES2의 mRNA 발현에도 영향을 미칠 것으로 예상되었다.

Real-time PCR을 이용한 pro-inflammatory cytokine(TNFα, IL1β, IL6, MCP1, PTGES2) mRNA 발현 억제 측정

말오줌나무잎 phenolic의 pro-inflammatory cytokines(TNFα, IL1β, IL6, MCP1, PTGES2) mRNA 발현량을 확인하기 위해 LPS 자극한 Raw cell에 LPS 1µg/mL와 말오줌나무잎 phenolics을 25–75µg/mL의 농도로 처리하여 mRNA 발현을 RT-PCR로 측정한 결과 Fig. 4에서와 같이 TNFα mRNA 발현량은 control 1.0에 대해 75µg/mL phenolics 농도에서 물 추출물(A)과 에탄올 추출물(B)에서 각각 0.70과 0.43의 TNFα mRNA 발현량을 나타내어 LPS 자극만 처리한 control군과 비교하였을 때 0.30과 0.57의 발현 억제 효과를 확인하였다. IL1β mRNA의 경우에는 75µg/mL phenolics 농도에서 물 추출물(C)과 에탄올 추출물(D)에서 각각 0.70과 0.63의 IL1β mRNA 발현량을 나타내어 control군과 비교하였을 때 0.30과 0.37의 발현 억제 효과를 확인하였다. IL6 mRNA의 경우에는 75µg/mL phenolics 농도에서 물 추출물(E)과 에탄올 추출물(F)에서 각각 0.68과 0.61의 IL6 mRNA 발현량을 나타내어 control군과 비교하였을 때 0.32와 0.39의 발현 억제 효과를 확인하였다. MCP1 mRNA의 경우에는 75µg/mL phenolics 농도에서 물 추출물(G)과 에탄올 추출물(H)에서 각각 0.55와 0.46의 MCP1 mRNA 발현량을 나타내어 control군과 비교하였을 때 0.45와 0.54의 높은 발현 억제 효과를 나타내었다. PTGES2 mRNA의 경우에는 75µg/mL phenolics 농도에서 물 추출물(I)과 에탄올 추출물(J)에서 각각 0.54와 0.60의 PTGES2 mRNA 발현량을 나타내어 control군과 비교하였을 때 0.46과 0.40의 발현 억제 효과를 확인하였다.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-03/N020250042/images/HST_20250042_F4.jpg
Fig. 4.

Sambucus sieboldiana phenolics reduced the mRNA expression levels of cytokine-associated genes. LPS-stimulated cells were treated with 25‒75 μg/mL of Sambucus sieboldiana phenolics and incubated for 18 h. The mRNA expression levels of the pro-inflammatory cytokines mRNA TNFα (A&B), IL1β (C&D), IL6 (E&F), MCP1 (G&H), and PTGES2 (I&J) were measured by real-time PCR. Relative mRNA expression levels were normalized with β-actin. Data are presented as the mean ± SD (n=3). Means with different letters are significant (p < 0.05).

위의 결과에 따라 LPS에 의해 자극된 Raw cell에서 pro-inflammatory cytokine mRNA 발현이 말오줌나무잎 phenolics에 의해서 농도 의존적으로 감소하는 것을 확인하였다. 말오줌나무잎 phenolics는 MCP-1 cytokine 생성에 관여하는 MCP1 mRNA 발현을 억제하였으며, 염증성 cytokine(TNF-α, IL-1β, IL-6) 생성에 관여하는 TNFα, IL1β, IL6 mRNA와 COX-2에 의해 자극받아 PGE2 생성에 관여하는 PTGES2 mRNA 발현을 억제하는 것이 확인되어 높은 항염증 효과를 기대할 수 있는 agent로 확인되었다.

또한 전반적으로 물 추출물 보다 에탄올 추출물에서 항염증 효과가 더 우수한 것으로 나타났으며, 이는 추출물에 함유되어 있는 phenolic profile의 차이에 기인한 것으로 추측되었다. 따라서 향후 추출물의 phenolic profile에 대한 연구와 생리활성 자원인 말오줌나무를 원예작물로 활용할 수 있는 재배조건을 검토하고, 나아가서 callus 제조에 의한 기내조직배양에 관한 연구도 추진되어야 할 것으로 사료되었다.

References

1

Carmichael J, DeGraff WG, Gazdar AF, Minna JD, Mitchell JB (1987) Evaluation of a tetrazolium based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Research 47:936-942

2

Chae JW, Cho YJ (2012) Antioxidative activity of extracts from Sambucus williansii var. coreana, Korean J Plant Res 25:363-371. https://doi.org/10.7732/kjpr.2012.25.4.363

10.7732/kjpr.2012.25.4.363
3

Cho YJ (2011) Anti-infammatory effect of Jatrorrhizine from Phelodendron amurense in lipopolysaccharide-stimulated Raw264.7 cells. J Appl Biol Chem 54:114-119. https://doi.org/10.3839/jabc.2011.020

10.3839/jabc.2011.020
4

Cho YJ, An BJ (2008) Anti-infammatory efect of extracts from Cheongmoknosang (Morus alba L.) in lipopolysaccharide-stimꠓulated Raw cells. Appl Biol Chem 51:44-48

5

Choi MS, Yang JK (2008) Industrial potentiality of wild edible greens. J Food Res Technol 21:1-7

6

Chung GY, Park MS, Nam BN, Hong KN, Jang J, Lee CH (2010) The regional folk plants in inland of Gyeongsangbuk-do (Ⅰ). Korean J Plant Res 23:465-479

7

Chung GY, Park MS, Nam BN, Jeong DH, Lee CH, Shin YH, Kim HJ, Kang SH (2011) The folk plants in southern region of Gangwon-do. Korean J Plant Res 24:379-394. https://doi.org/10.7732/kjpr.2011.24.4.379

10.7732/kjpr.2011.24.4.379
8

Claude S, Manabu K, Laura M, Lester P (1999) Antioxidants modulate acute solar ultraviolet radiation-induced NF-kappa-B activation in a human keratinocyte cell line. Free Radic Biol Med 26:174-183. https://doi.org/10.1016/S0891-5849(98)00212-3

10.1016/S0891-5849(98)00212-39890652
9

Folin O, Denis W (1912) On phoshotungstic-phosphomolybdic compounds as color reagents. J Biol Chem 12:239-243. https://doi.org/10.1016/S0021-9258(18)88697-5

10.1016/S0021-9258(18)88697-5
10

Halliwell B, Gutteridge JM (1992) Free radicals, antioxidants and human disease: Where are we now? J Lab Clinical Medicine 119:598-620

11

Han IA (2010) A study on the antibacterial and antioxidative effects of each fraction of Ligularia stenocephala, Ligularia fischeri, and Aster scaber extracts. Dissertation, Chungnam National University

12

Im HT, Hong HH, Son HD, Park MS, Nam BM, Kwon BK, Lee CH, Chung GY (2011) The usage of regional folk plants in Gyeongsangnam-do. Korean J Plant Res 24:419-429. https://doi.org/10.7732/kjpr.2011.24.4.419

10.7732/kjpr.2011.24.4.419
13

Jeong HR, Choi K, Park GW (2012) The regional folk plants in southern inland area of Gyeonggi-do. Korean J Plant Res 25:523-542. https://doi.org/10.7732/kjpr.2012.25.5.523

10.7732/kjpr.2012.25.5.523
14

Kim HJ, Lee DJ, Ku JJ, Choi K, Park KW, Kang SH, Moon C, Lee PJ (2013) Anti-inflammatory effect of extracts from folk plants in ulleung island, Korean J Plant Res 26:167-177. https://doi.org/10.7732/kjpr.2013.26.2.169

10.7732/kjpr.2013.26.2.169
15

Kim JB, Han AR, Park EY, Kim JY, Cho W, Lee J (2007) Inhibition of LPS-induced iNOS, COX-2 and cytokines expression by Poncirin through the NF-kB inactivation in RAW 264.7 macrophage cells. Biol Pharm Bull 30:2345-2351. https://doi.org/10.1248/bpb.30.2345

10.1248/bpb.30.234518057724
16

Kim JH, Kim MK (1999) Effect of dried leaf powders and ethanol extracts of perilla frutescens, artemisia princeps var orientalis and Aster Scaber on lipid metabolism and antioxidative capacity in rats. Korean J Nutr 32:540-551

17

Kim JY, Jung KS, Jeong HG (2004b) Suppressive effects of the kahweol and cafestol on cyclooxygenase-2 expression in macꠓrophages. FEBS Lett 569:321-326. https://doi.org/10.1016/j.febslet.2004.05.070

10.1016/j.febslet.2004.05.07015225655
18

Kim KA, Han JS, Cheon KS, Jang JH, Ok GH, Yoo KO (2012) Folk plants in the inland of northern area in Gangwon-do. Korean J Plant Res 25:48-62. https://doi.org/10.7732/kjpr.2012.25.1.048

10.7732/kjpr.2012.25.1.048
19

Kim KT (2013) Antioxidant activity and protective effects of extracts from Sambucus williamsii var. coreana on t-BHP induced oxidative stress in chang cells. J Soc Korean Med Diagnostics 17:275-286

20

Kim SC, Jung YS, Lee JR, Kim YW, Byun BH, Kwon TK, Suh SI, Byun SH, Kwon YK (2004a) Inhibitory efect of Phellinus Igniarius water extract on TNF-α, IL-1β, IL-6 and nitric oxide producꠓtion in lipopolysaccharide-activated Raw 264.7 cells. Kor J Orient Physiol Pathol 18:880-886

21

Kim SJ, Um JY, Lee JY (2011) Anti-infammatory activity of hyperoside through the suppression of nuclear factor-kappaB activation in mouse peritoneal macrophages. Am J Chin Med 39:171-181. https://doi.org/10.1142/S0192415X11008737

10.1142/S0192415X1100873721213407
22

Kim SN, Lee CM, Lee SH, Kim YC (2013) Inhibitory efficacy of water soluble extracts from green, white and black teas on MMP-2 activity and MMP-1 gene expression in human dermal fibroblasts. J Invest Cosmet 9:21-26. https://doi.org/10.15810/jic.2013.9.1.004

10.15810/jic.2013.9.1.004
23

Lee CB (2014) Coloured flora of korea. Hyang mun publishing, Seoul, Korea

24

Lee DG, Kim EJ, Lee ES, Wang Kh, Cho HS, Lee SD, Kim KS, Kim KH (2012) Effect of suppressing the activation of macrophage migration inhibitory factor by Sambucus williamsii HANCE Extract & Pharmacopuncture Solution on Type Ⅱ collagen-induced arthritis. J Korean Acupuncture & Moxibustion Society 29:103-113

25

Lee E (2011) Efects of Ixeris dentata extract on the production of proinfammatory cytokines in the LPS stimulated rat and Raw 2647 cells. Kor J Plant Res 24:604-612. https://doi.org/10.7732/kjpr.2011.24.5.604

10.7732/kjpr.2011.24.5.604
26

Lee SJ (1966) Korean folk medicine. Publishing center of seoul national university, Seoul

27

Lee YS, Joo EY, Kim NW (2005) Antioxidant activity of extracts from the Lespedeza bicolor. Korean J Food Preserv 12:75-79

28

Li Q, Verma IM (2002) NF-kappaB regulation in the immune system. Nat Rev Immunol 2:725-734. https://doi.org/10.1038/nri910

10.1038/nri91012360211
29

McCartney-Francis N, Allen JB, Mizel DE, Albina JI, Xie QW, Nathan CF, Wahl SM (1993) Suppression of arthritis by an inhibitor of nitric oxide synthase. J Exp Med 178:749-754. https://doi.org/10.1084/jem.178.2.749

10.1084/jem.178.2.7497688035PMC2191124
30

Mignard P, Beguería S, Reig G, Font I, Forcada CF, Moreno MA (2021) Genetic origin and climate determine fruit quality and antioxidant traits on apple (Malus x domestica Borkh). Sci Hortic 285:110142. https://doi.org/10.1016/j.scienta.2021.110142

10.1016/j.scienta.2021.110142
31

Moncada S, Palmer RM, Higgs EA (1991) Nitric oxide: physiology, pathophysiology and pharmacology. Pharmacol Rev 43:109-142. https://doi.org/10.1016/S0031-6997(25)06663-3

10.1016/S0031-6997(25)06663-31852778
32

Park HJ, Lee EH, Jeong DE, Han CW, Kim BO, Kang IK, Cho YJ (2022) Biological activity of functional foods and anti-microbial activity of phenolics from Sambucus sieboldiana var. pendula leaves. Kor J Food Sci Technol 54:386-390

33

Park JH (1993) Studies on the origin of korean folk medicine, Korean J Pharmacogn 24:322-327

34

Park JH, Keon DK, Do WI (2006) Pharmacognostical studies on the "jeob gol mog". Korean J Pharmacogn 37:120-123

35

Ryu JH, Ahn H, Kim JY, Kim YK (2003) Inhibitory activity of plant extracts on nitric oxide synthesis in LPS-activated macrophages. Phytother Res 17:485-489. https://doi.org/10.1002/ptr.1180

10.1002/ptr.118012748984
36

Seo SJ, Shim KB, Kim NW (2011) Antioxidant effects of solvent fraction from Nandina domestica fruits. J Korean Soc Food Sci Nutr 40:1371-1377. https://doi.org/10.3746/jkfn.2011.40.10.1371

10.3746/jkfn.2011.40.10.1371
37

Surh YJ (2002) Anti-tumor promoting potential of selected spice ingreꠓdients with antioxidative and anti-infammatory activities: a short review. Food Chem Toxicol 40:1091-1097. https://doi.org/10.1016/S0278-6915(02)00037-6

10.1016/S0278-6915(02)00037-612067569
38

Valko M, Leibfritz D, Monocol J, Cronin MT, Mazur M, Telser J (2007) Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol 39:44-84. https://doi.org/10.1016/j.biocel.2006.07.001

10.1016/j.biocel.2006.07.00116978905
39

Wang X, Liu C, Wang Q, Liu C, Sun H, Zhang M, Du G (2021) A comparative study on antioxidant, anti‐inflammatory, antimicrobial activities and chemical composition of Pyrus ussuriensis cultivars from northeastern China. Hortic Environ Biotechnol 62:477-491. https://doi.org/10.1007/s13580-020-00322-x

10.1007/s13580-020-00322-x
40

Wina NM, Yoo JG, Naing AH, Kwon JG, Kang IK (2021) 1-Methylꠓcyclopropene (1-MCP) treatment delays modifcation of cell wall pectin and fruit softening in "Hwangok" and "Picnic" apples durꠓing cold storage. Postharvest Biol Technol 180:11. https://doi.org/10.1016/j.postharvbio.2021.111599

10.1016/j.postharvbio.2021.111599
41

Xu X, Wang W, Lin L, Chen P (2020) Liraglutide in combination with human umbilical cord mesenchymal stem cell could improve liver lesions by modulating TLR4/NF-kB infammatory pathway and oxidative stress in T2DM/NAFLD rats. Tissue Cell 66:101382. https://doi.org/10.1016/j.tice.2020.101382

10.1016/j.tice.2020.10138232933722
42

Yoo HK, Jeong JH (2000) The Effect of Sambucus williamsii Hance(SWH) on Osteoporosis induced by Ovariotomy in rats, J orient Gynecology 13:262-302

43

Yu M, Gouvinhas I, Rocha J, Barros AI (2021) Phytochemical and antiꠓoxidant analysis of medicinal and food plants towards bioactive food and pharmaceutical resources. Sci Rep 11:10041. https://doi.org/10.1038/s41598-021-89437-4

10.1038/s41598-021-89437-433976317PMC8113553
44

Yun HJ, Lim SY, Hur JM, Jeong JW, Yang SH, Kim DH (2007) Changes of functional compounds in, and texture characteristics of, apples, during post-irradiation storage at diferent temperaꠓtures. Korean J Food Preserv 14:239-24

페이지 상단으로 이동하기