Research Article

Horticultural Science and Technology. 31 August 2023. 463-495
https://doi.org/10.7235/HORT.20230042

ABSTRACT


MAIN

  • 서 언

  • 재료 및 방법

  •   잔디 유전자원

  •   잔디의 DNA 추출 및 ITS 기반 CAPS 마커 분석

  •   잔디의 TaqMan SNP genotyping assay 분석

  •   분자생물학적 식별된 한국잔디류의 서식환경별 분포 조사

  •   분자생물학적 식별된 한국잔디 유전자원의 주요 외부형태적 특성인 엽폭 조사

  • 결과 및 고찰

  •   수집된 대량의 한국잔디류 유전자원의 ITS 기반 CAPS 마커 분석과 ITS 기반 TaqMan SNP genotyping assay 분석에 의한 분자생물학적 잔디 식별

  •   분자생물학적으로 식별된 들잔디, 갯잔디 및 교잡종 잔디의 서식환경별 분포 조사

  •   분자생물학적으로 식별된 들잔디, 갯잔디, 들잔디와 갯잔디의 교잡종의 잎의 너비 분석

서 언

잔디(turf grass)는 토양의 침식방지, 도시 녹화, 휴식, 여가생활, 소음 및 공해 방지 등의 목적으로 도로변, 경사면, 산림 훼손지, 건물 정원, 도시 공원, 스포츠 경기장, 골프장, 학교운동장 등의 다양한 장소에 식재되고 있는 원예작물이며 점차 사용 범위가 확대되고 있다(Yu et al., 1974; Choi and Yang, 2006a; Sun et al., 2010; Hyun et al., 2012; Bae et al., 2013; Song et al., 2017). 이러한 잔디는 주로 생육 적온에 따라 고온에 강한 난지형 잔디 및 저온에 강한 한지형 잔디로 크게 분류된다(Kim and Lee, 2010). 난지형 잔디는 들잔디(Zoysia japonica), 갯잔디(Z. sinica), 금잔디(Z. matrella), 왕잔디(Z. macrostachya), 버뮤다그라스(Cynodon dactylon) 등이 있고, 한지형 잔디는 켄터키 블루그라스(Poa pratensis), 크리핑 벤트그라스(Agrostis stolonifera), 라이그라스(Lolium perenne), 톨훼스큐(Festuca arundinacea) 등이 있다(Kim and Lee, 2010; Bae et al., 2013; Choi, 2017). 우리나라에서 주로 자생하고 있는 잔디는 난지형 잔디로 화본과 Zoysia 속의 한국잔디류(Zoysiagrass)이며, 주로 들잔디 및 갯잔디가 많이 자생하고 있고, 드물게 금잔디 및 왕잔디가 자생하고 있다(Yu et al., 1974; Li et al., 2006; Bae et al., 2010; Kim and Lee, 2010; Sun et al., 2010; Hyun et al., 2012; Bae et al., 2013; Chung et al., 2013; Lee et al., 2013; Choi, 2017). 이러한 한국잔디류는 주로 영양번식하는 다년생의 타가수정작물이며, 온대기후부터 열대기후의 아시아 지역인 한국 및 중국, 일본, 뉴질랜드, 네팔, 태국, 필리핀 등의 아시아 지역에 자생하는 대표적인 난지형 잔디이다(Yu et al., 1974; Kim and Lee, 2010; Sun et al., 2010; Hyun et al., 2012). 난지형 잔디인 한국잔디류는 한지형 잔디보다 고온 및 건조, 해안지대의 염분, 병충해, 답압 등에 강한 특성이 있어 우수한 신품종 육종을 위한 중요한 소재로 사용되는 유전자원이다(Yu et al., 1974; Li et al., 2006; Sun et al., 2010; Hyun et al., 2012; Chung et al., 2013). 한국잔디류에 속하는 들잔디는 주로 산, 내륙, 해안가에서 자생하며 갯잔디는 갯벌, 바닷가의 바닷물 인접지역에서 자생하기 때문에 들잔디에 비해 갯잔디가 내염성은 더 강하다(Yu et al., 1974; Hong and Yeam, 1985; Li et al., 2006; Sun et al., 2010; Hyun et al., 2012; Chung et al., 2013). 들잔디와 갯잔디의 각 생육특성을 살펴보면, 들잔디의 경우에는 지표면 근쳐에서 낮게 자라는 low-growing creeping type이며 갯잔디의 경우에는 지표면 위로 약간 서서 자라는 high-growing type이고, 들잔디에 비해 갯잔디의 생육속도는 매우 느린편이다(Hong and Yeam, 1985). 이러한 생육특성으로 잔디 잎의 밀도가 달라지는데, 본 연구소의 들잔디와 갯잔디의 교잡종의 경우에는 갯잔디보다 밀도가 확연히 높은 타입이 많아 고밀도의 내염성 품종으로 더 우수한 품종을 육성할 수 있어 교잡종도 중요한 유전자원이다.

󰡔유전자원에 대한 접근 및 그 이용으로부터 발생하는 이익의 공정하고 공평한 공유에 관한 생물다양성에 관한 협약 나고야 의정서󰡕에 따라 우리나라에서도 국내의 다양한 유전자원을 대상으로 나고야 의정서의 적용과 관련된 대비가 시급하다. 우리나라는 전국에 자생하는 잠재된 우수한 한국잔디류 유전자원을 보유하고 있으나 아직 국내 유전자원을 수집 및 보존, 관리, 분류 동정, 품종 육성, 산업화가 해외에 비해 적은 실정이다(Choi et al., 1997; Choi and Yang, 2004, 2006a, 2006b; Yang et al., 2016a; Choi, 2017; Song et al., 2017; Choi et al., 2018; Yang et al., 2021a, 2021b). 본 연구팀은 2012년부터 최근까지 한국에 자생하는 한국잔디류를 각각 다른 지역에서 수집하여 제주대학교 아열대원예산업연구소 유전자원 시험포장 및 비닐온실에서 보존, 증식, 분류 및 관리하고 있으며, 선발 및 돌연변이 육종, 품종보호 출원 및 등록하여 우수한 형질의 한국잔디류를 육성해 왔다(Yang et al., 2016a; Hong et al., 2017; Song et al., 2017; Yang et al., 2021a, 2021b). 또한, 한국에 많이 자생하고 있는 들잔디와 갯잔디의 난지형 한국잔디류와 켄터키블루그라스와 크리핑벤트그라스의 한지형 잔디들을 신속 정확하게 분자생물학적으로 종별 식별할 수 있는 분자마커를 개발하였다(Hong et al., 2017). 다양한 장소에서 수집 보존중인 한국잔디류의 경우, 확연히 다른 환경인 산에서 수집된 들잔디나 갯벌 또는 바닷가 바위에서 수집된 갯잔디들은 외부형태학적인 명확한 차이 때문에 종 분류 동정은 쉽게 가능하다. 그러나, 해안가와 섬지역 같은 바다와 가까운 환경에서 수집된 야생 들잔디, 갯잔디 및 들잔디와 갯잔디의 교잡종은 외형이 매우 유사하여 비전문가의 경우 외부형태학적 분류동정이 쉽지 않다(Yang et al., 1995; Hong et al., 2017). 이러한 이유로, 본 연구실에서는 한국잔디류의 DNA 바코드 구간인 nuclear ribosomal DNA(nrDNA)의 internal transcribed spacer(ITS) 염기서열 차이에 의한 cleaved amplified polymorphic sequence(CAPS) 마커를 개발하여 들잔디, 갯잔디, 그들의 교잡종의 분류 동정 기법을 성공적으로 확립하였다(Hong et al., 2017). ITS 기반 DNA 바코드 분석은 다양한 생물 분류 동정을 위하여 활발히 연구되어 왔으며, 종 및 속간 유연관계, 진화 양상, 한약제 위품 구별 등 신속 정확한 분석을 위하여 활용되고 있다(Gehrig et al., 2001; Hebert et al., 2003; Kunihisa et al., 2003; Kress et al., 2005; Han et al., 2006; Kress and Erickson, 2008; Baigalmaa et al., 2009; CBOL Plant Working Group, 2009; Ahn et al., 2010; Gao et al., 2010; Koch, 2010; Yao et al., 2010; China Plant BOL Group, 2011; Hong et al., 2012; Kim et al., 2012; Moon et al., 2013; Kim et al., 2015; Hong et al., 2017).

수집된 야생 한국잔디류 유전자원은 본 연구팀에서 개발한 ITS 염기서열 차이 기반 CAPS 분자마커로 들잔디, 갯잔디, 그들의 교잡종까지 정확하게 식별이 가능하였지만, 다량 분석을 수행하는데 많은 시간과 노동력이 소요되어, 좀 더 신속하고 정확한 식별방법이 요구되었다. 최근 형광물질을 활용한 single-nucleotide polymorphism(SNP) 기반 TaqMan probe 및 Kompetitive allele-specific PCR(KASP)기술 등의 방법으로 단일염기다형성 유전자형 분석(SNP genotyping assay)을 손쉽게 할 수 있는 분자표지 기술이 개발되어 활용되고 있다. TaqMan probe에 의한 SNP genotyping assay 분석법은 원하는 염기서열 구간의 SNP를 Real-time PCR을 이용하여 유전변이, 생물종 식별 및 작물 육종시 우수라인 선발 등의 분석에 활용되고 있다(Tan et al., 2017; Broccanello et al., 2018; Ayalew et al., 2019; Kang et al., 2020; Shin et al., 2020). ITS 기반 CAPS 마커는 정확도는 높으나 많은 시간과 노동력이 소요된다. TaqMan probe 기술의 SNP genotyping assay set 분석법은 Real-time PCR 후 분류 동정 결과를 그래프 및 표로 신속 정확하게 확인할 수 있어 시간과 노동력을 줄일 수 있다.

본 연구에서는 기존 ITS 기반 CAPS 마커를 활용하여 수집되어 보존 중인 다량의 한국잔디류 유전자원을 추가 분류 동정하였다. 또한, 다량의 유전자원을 좀 더 신속 정확하게 분류 동정 하기 위하여 ITS 기반 TaqMan SNP genotyping assay 분석법을 개발하여 종을 구별하였으며, ITS 기반 CAPS 마커의 결과와 비교하였다. 또한 분류 동정된 들잔디, 갯잔디, 교잡종을 기반으로 서식환경별 분포를 조사하였으며, 기존 외부형태학적으로 주요한 분류 형질인 잎의 너비(엽폭)가 들잔디와 갯잔디 교잡종의 분류동정에 이용할 수 있는지 분석하였다.

재료 및 방법

  잔디 유전자원

본 연구에서 사용된 한국잔디류 유전자원은 본 연구팀이 2012년부터 2018년도까지 한국 주요 지역인 서울 및 인천을 포함하는 경기도권, 강원도, 충청남북도, 전라남북도, 경상남북도, 제주도 지역을 중심으로 수집하였다. 특히 한국잔디류의 자생지인 각 지역의 내륙의 국립공원 산 및 동 ․ 서 ․ 남해안 부근의 해안과 섬, 제주 지역의 오름 및 해안과 부속 섬 등의 각각 다른 지역에서 한국잔디류를 10–15cm 내외 사각형으로 수집하였고, 국립공원으로 명시된 곳은 국립공원관리공단의 허가하에 수집하였다. 수집된 영양체는 제주대학교 아열대원예산업연구소에서 시험포장 및 비닐온실에서 보존 및 증식하였고, 수집된 종자는 저온저장고에 보존하였다. 수집하여 보존된 한국잔디류는 620점(영양체 555점 및 종자 65점)이며, 영양체의 각 잔디의 잎은 엽폭을 조사한 후에 에탄올 소독하여 DNA 추출 재료로 사용되었다. 분자생물학적 분류 동정을 위하여 사용된 대조구는 기존에 본 연구팀에서 보고한 ITS 기반 CAPS 마커방법(Hong et al., 2017)으로 분자생물학적 분류동정이 이미 완료된 들잔디(Z. japonica, China; Zj-C)의 판매 종자 및 수집된 갯잔디(Z. sinica, Jeju, Korea; Zs-C)종자, 들잔디와 갯잔디의 교잡종(Z. japonica and Z. sinica hybrid, Jeju, Korea; H-C) 종자로부터 확보한 잔디이며, ITS 기반 CAPS 마커 및 ITS 기반 TaqMan SNP genotyping assay 분석법에 의한 분자생물학적 분류를 위해서 대조구로 사용되었다(Table 1). 대조구인 종자는 소독 및 파종 후 MS(Murashige and Skoog, 1962) 기본 배지에 배양되었으며, 각 잔디 잎은 DNA 추출 재료로 사용되었다. 수집하여 보존 및 증식한 자생 Zoysia 속 한국잔디류 들잔디 및 갯잔디 계통의 영양체 중에서 450점은 대조구와 비교 분석하여 ITS 기반 CAPS 마커 및 ITS 기반 TaqMan SNP genotyping assay의 대량 분류 동정을 위한 DNA 추출 재료로 사용되었다(Table 1). 분자생물학적 분류 동정된 들잔디, 갯잔디 및 들잔디와 갯잔디의 교잡종은 서식환경별 분포를 분석하였다.

Table 1.

Molecular identification of collected zoysiagrass plants: A total of 450 collected zoysiagrass plants were classified into 234 Zoysia japonica plants, 62 Zoysia sinica plants, and 154 Z. japonica and Z. sinica hybrid plants by molecular identification using the ITS-based CAPS marker analysis and ITS-based TaqMan SNP genotyping assays

Sample
Name
Origin Classification according to the molecular method of the
collected zoysiagrass plants
Molecular
classification
using ITS-based CAPS,
ITS-based TaqMan
SNP genotyping assay
CAPS marker analysis TaqMan SNP
genotyping assay
Zj-C Imported seed, China, control Zj Zj Zj
Zs-C Collected seed, Jeju, Korea, control Zs Zs Zs
H-C Collected seed, Jeju, Korea, control H H H
1 Cheonan-Si, Korea, 'Yaji' Zj Zj -
11 Imported seed, China Zj Zj -
13 Onpyung, Jeju, Korea Zj Zj -
14 Shinyang, Jeju, Korea Zj Zj -
16 Seongsan, Jeju, Korea Zj Zj -
17 Seongsan, Jeju, Korea Zj Zj -
18 Seongsan, Jeju, Korea H H -
19 Seongsan, Jeju, Korea H H -
20 Onpyung, Jeju, Korea H H -
23 Geomunoreum, Jeju, Korea Zj Zj -
24 Seongsan, Jeju, Korea H H -
25 Andeok, Jeju, Korea H H -
26 Shinyang, Jeju, Korea Zj Zj -
28 Onpyung, Jeju, Korea Zj Zj -
29 Onpyung, Jeju, Korea Zj Zj -
30 Shinyang, Jeju, Korea H H -
31 Onpyung, Jeju, Korea H H -
32 Shinyang, Jeju, Korea Zj Zj -
34 Baegyagioreum, Jeju, Korea Zj Zj -
35 Baegyagioreum, Jeju, Korea Zj Zj -
37 Baegyagioreum, Jeju, Korea Zj Zj -
38 Gapado Island, Jeju, Korea H H -
40 Gapado Island, Jeju, Korea H H -
42 Gapado Island, Jeju, Korea H H -
44 Wemi, Jeju, Korea Zs Zs -
46 Gapado Island, Jeju, Korea H H -
47 Wemi, Jeju, Korea H H -
48 Wemi, Jeju, Korea H H -
51 Shinrye, Jeju, Korea H H -
52 Hyodon, Jeju, Korea Zj Zj -
53 Hyodon, Jeju, Korea H H -
56 Bomok, Jeju, Korea Zj Zj -
57 Bomok, Jeju, Korea H H -
58 Yeongpyeong, Jeju, Korea Zj Zj -
60 Kashiri, Jeju, Korea Zj Zj -
61 Daelogsan, Jeju, Korea Zj Zj -
63 Daelogsan, Jeju, Korea Zj Zj -
66 Moseulpo, Jeju, Korea H H -
67 Moseulpo, Jeju, Korea Zj Zj -
68 Moseulpo, Jeju, Korea Zj Zj -
69 Moseulpo, Jeju, Korea Zs Zs -
70 Moseulpo, Jeju, Korea Zj Zj -
71 Moseulpo, Jeju, Korea Zj Zj -
72 Moseulpo, Jeju, Korea H H -
74 Moseulpo, Jeju, Korea Zj Zj -
75 Moseulpo, Jeju, Korea H H -
76 Gosan, Jeju, Korea Zs Zs -
77 Gosan, Jeju, Korea H H -
79 Gosan, Jeju, Korea H H -
80 Gosan, Jeju, Korea Zs Zs -
81 Gosan, Jeju, Korea Zs Zs -
82 Gosan, Jeju, Korea H H -
84 Gosan, Jeju, Korea H H -
85 Gosan, Jeju, Korea Zs Zs -
86 Gosan, Jeju, Korea H H -
87 Daejeong, Jeju, Korea Zs Zs -
88 Daejeong, Jeju, Korea H H -
89 Daejeong, Jeju, Korea Zs Zs -
90 Daejeong, Jeju, Korea Zs Zs -
92 Daejeong, Jeju, Korea H H -
93 Daejeong, Jeju, Korea Zs Zs -
94 Daejeong, Jeju, Korea H H -
95 Gochang, Jeollabuk-do, Korea Zj Zj -
96 Gochang, Jeollabuk-do, Korea Zj Zj -
97 Gochang, Jeollabuk-do, Korea Zj Zj -
98 Hallasan Gwaneumsa, Jeju, Korea Zj Zj Zj
99 Hallasan Gwaneumsa, Jeju, Korea Zj Zj Zj
100 Hallasan Gwaneumsa, Jeju, Korea Zj Zj Zj
101 Hallasan Gwaneumsa, Jeju, Korea Zj Zj Zj
102 Hallasan Gwaneumsa, Jeju, Korea Zj Zj -
103 Hallasan Seongpanak, Jeju, Korea Zj Zj -
104 Hallasan Seongpanak, Jeju, Korea Zj Zj -
105 Hallasan Seongpanak, Jeju, Korea Zj Zj Zj
106 Hallasan Seongpanak, Jeju, Korea Zj Zj Zj
109 Hallasan Seongpanak, Jeju, Korea Zj Zj -
110 Hallasan Seongpanak, Jeju, Korea Zj Zj Zj
111 Hallasan Seongpanak, Jeju, Korea Zj Zj Zj
112 Hallasan Seongpanak, Jeju, Korea Zj Zj Zj
113 Hallasan Seongpanak, Jeju, Korea Zj Zj Zj
114 Hallasan Seongpanak, Jeju, Korea Zj Zj Zj
115 Iseung-ag, Jeju, Korea Zj Zj -
118 Pyoseon, Jeju, Korea Zs Zs Zs
119 Pyoseon, Jeju, Korea Zs Zs Zs
120 Pyoseon, Jeju, Korea H H H
121 Pyoseon, Jeju, Korea H H H
122 Pyoseon, Jeju, Korea H H -
125 Pyoseon, Jeju, Korea Zj - Zj
129 Pyoseon, Jeju, Korea Zs Zs -
130 Pyoseon, Jeju, Korea H H -
131 Jirisan, Jeollabuk-do, Korea Zj Zj Zj
132 Jirisan, Jeollabuk-do, Korea Zj Zj Zj
133 Jirisan, Jeollabuk-do, Korea H H H
134 Jirisan, Jeollabuk-do, Korea Zj Zj Zj
135 Jirisan, Jeollabuk-do, Korea Zj Zj -
136 Jirisan, Jeollabuk-do, Korea Zj Zj -
138 Jirisan, Jeollabuk-do, Korea Zj Zj Zj
142 Jirisan, Jeollabuk-do, Korea Zj Zj Zj
145 Hallasan Donnaeko, Jeju, Korea Zj Zj Zj
146 Hallasan Donnaeko, Jeju, Korea Zj Zj Zj
147 Hallasan Donnaeko, Jeju, Korea Zj Zj -
149 Wolchulsan, Jeollanam-do, Korea Zj Zj -
151 Wolchulsan, Jeollanam-do, Korea Zj Zj -
154 Wolchulsan, Jeollanam-do, Korea Zj Zj -
157 Deogyusan, Jeollabuk-do, Korea Zj Zj -
158 Deogyusan, Jeollabuk-do, Korea Zj Zj -
159 Deogyusan, Jeollabuk-do, Korea Zj Zj Zj
160 Heuksando Island, Jeollanam-do, Korea Zj Zj -
161 Heuksando Island, Jeollanam-do, Korea Zj Zj -
162 Heuksando Island, Jeollanam-do, Korea Zj Zj -
165 Heuksando Island, Jeollanam-do, Korea H H H
166 Heuksando Island, Jeollanam-do, Korea H H H
167 Heuksando Island, Jeollanam-do, Korea H H H
168 Heuksando Island, Jeollanam-do, Korea Zj Zj Zj
169 Heuksando Island, Jeollanam-do, Korea Zj Zj -
171 Bogildo Island, Jeollanam-do, Korea Zs Zs -
172 Bogildo Island, Jeollanam-do, Korea Zs Zs -
174 Bogildo Island, Jeollanam-do, Korea H H -
175 Bogildo Island, Jeollanam-do, Korea Zj Zj -
178 Bogildo Island, Jeollanam-do, Korea Zj Zj Zj
179 Bogildo Island, Jeollanam-do, Korea Zj Zj -
180 Bogildo Island, Jeollanam-do, Korea H H -
182 Bogildo Island, Jeollanam-do, Korea Zs Zs -
183 Ando Island, Jeollanam-do, Korea H H -
185 Geumodo Island, Jeollanam-do, Korea Zj Zj -
186 Geumodo Island, Jeollanam-do, Korea Zj Zj -
187 Geumodo Island, Jeollanam-do, Korea Zj Zj -
188 Geumodo Island, Jeollanam-do, Korea Zj Zj -
189 Geumodo Island, Jeollanam-do, Korea Zj Zj Zj
191 Geumodo Island, Jeollanam-do, Korea H H -
193 Geumodo Island, Jeollanam-do, Korea H H H
194 Geumodo Island, Jeollanam-do, Korea Zj Zj Zj
195 Geumodo Island, Jeollanam-do, Korea Zj Zj Zj
196 Geogeumdo Island, Jeollanam-do, Korea Zj Zj -
198 Geogeumdo Island, Jeollanam-do, Korea Zs Zs -
200 Geogeumdo Island, Jeollanam-do, Korea H H -
202 Geogeumdo Island, Jeollanam-do, Korea Zj Zj Zj
203 Geogeumdo Island, Jeollanam-do, Korea Zj Zj -
204 Geogeumdo Island, Jeollanam-do, Korea Zj Zj Zj
205 Geogeumdo Island, Jeollanam-do, Korea H H H
206 Geogeumdo Island, Jeollanam-do, Korea H H H
207 Geogeumdo Island, Jeollanam-do, Korea Zj Zj Zj
209 Geogeumdo Island, Jeollanam-do, Korea H H -
210 Geogeumdo Island, Jeollanam-do, Korea Zj Zj -
211 Geogeumdo Island, Jeollanam-do, Korea Zs Zs Zs
212 Gogeumdo Island, Jeollanam-do, Korea H H -
213 Gogeumdo Island, Jeollanam-do, Korea Zj Zj -
214 Gogeumdo Island, Jeollanam-do, Korea Zj Zj -
215 Gogeumdo Island, Jeollanam-do, Korea Zj Zj Zj
216 Gogeumdo Island, Jeollanam-do, Korea H H H
218 Gogeumdo Island, Jeollanam-do, Korea H H -
219 Gogeumdo Island, Jeollanam-do, Korea Zj Zj Zj
222 Gogeumdo Island, Jeollanam-do, Korea H H H
224 Gogeumdo Island, Jeollanam-do, Korea H H H
225 Hallasan Yeongsil, Jeju, Korea Zj Zj -
226 Hallasan Yeongsil, Jeju, Korea Zj Zj -
227 Hallasan Yeongsil, Jeju, Korea Zj Zj -
228 Hallasan Yeongsil, Jeju, Korea H H H
230 Aphaedo Island, Jeollanam-do, Korea Zs - Zs
231 Aphaedo Island, Jeollanam-do, Korea Zs - Zs
232 Aphaedo Island, Jeollanam-do, Korea H H H
233 Aphaedo Island, Jeollanam-do, Korea Zs - Zs
234 Aphaedo Island, Jeollanam-do, Korea H H -
235 Aphaedo Island, Jeollanam-do, Korea H H H
236 Aphaedo Island, Jeollanam-do, Korea Zs Zs Zs
237 Aphaedo Island, Jeollanam-do, Korea H H H
239 Aphaedo Island, Jeollanam-do, Korea H - H
240 Aphaedo Island, Jeollanam-do, Korea H H -
242 Aphaedo Island, Jeollanam-do, Korea H H H
244 Aphaedo Island, Jeollanam-do, Korea Zs Zs -
245 Aphaedo Island, Jeollanam-do, Korea H H -
247 Aphaedo Island, Jeollanam-do, Korea Zj Zj Zj
248 Aphaedo Island, Jeollanam-do, Korea H H -
249 Aphaedo Island, Jeollanam-do, Korea Zj Zj -
250 Aphaedo Island, Jeollanam-do, Korea H H H
251 Aphaedo Island, Jeollanam-do, Korea H H H
252 Aphaedo Island, Jeollanam-do, Korea H H H
253 Aphaedo Island, Jeollanam-do, Korea Zs - Zs
255 Jaeundo Island, Jeollanam-do, Korea H H -
257 Jaeundo Island, Jeollanam-do, Korea Zs Zs -
258 Jaeundo Island, Jeollanam-do, Korea Zj Zj -
260 Jaeundo Island, Jeollanam-do, Korea Zs Zs -
262 Jaeundo Island, Jeollanam-do, Korea H H -
263 Jaeundo Island, Jeollanam-do, Korea Zj Zj Zj
264 Jaeundo Island, Jeollanam-do, Korea Zj Zj Zj
266 Amtaedo Island, Jeollanam-do, Korea Zs Zs -
268 Amtaedo Island, Jeollanam-do, Korea Zj Zj -
269 Amtaedo Island, Jeollanam-do, Korea H H H
270 Amtaedo Island, Jeollanam-do, Korea H H H
271 Amtaedo Island, Jeollanam-do, Korea Zs Zs Zs
272 Amtaedo Island, Jeollanam-do, Korea Zj Zj Zj
273 Amtaedo Island, Jeollanam-do, Korea Zj Zj Zj
274 Amtaedo Island, Jeollanam-do, Korea Zs - Zs
275 Amtaedo Island, Jeollanam-do, Korea H H H
276 Amtaedo Island, Jeollanam-do, Korea Zs - Zs
279 Anjwado Island, Jeollanam-do, Korea Zj Zj -
280 Anjwado Island, Jeollanam-do, Korea Zj Zj Zj
281 Anjwado Island, Jeollanam-do, Korea Zs Zs Zs
283 Anjwado Island, Jeollanam-do, Korea Zj Zj Zj
284 Anjwado Island, Jeollanam-do, Korea Zs - Zs
285 Anjwado Island, Jeollanam-do, Korea Zs - Zs
286 Anjwado Island, Jeollanam-do, Korea Zs - Zs
287 Anjwado Island, Jeollanam-do, Korea H H H
288 Anjwado Island, Jeollanam-do, Korea Zj Zj -
289 Anjwado Island, Jeollanam-do, Korea Zj Zj -
290 Anjwado Island, Jeollanam-do, Korea Zs Zs -
291 Anjwado Island, Jeollanam-do, Korea H H -
292 Palgeumdo Island, Jeollanam-do, Korea H H -
294 Palgeumdo Island, Jeollanam-do, Korea H H H
295 Palgeumdo Island, Jeollanam-do, Korea H H H
296 Palgeumdo Island, Jeollanam-do, Korea Zs - Zs
297 Palgeumdo Island, Jeollanam-do, Korea H H H
298 Palgeumdo Island, Jeollanam-do, Korea H H H
299 Bigeumdo Island, Jeollanam-do, Korea Zs Zs Zs
300 Bigeumdo Island, Jeollanam-do, Korea Zj Zj Zj
301 Bigeumdo Island, Jeollanam-do, Korea H H H
302 Bigeumdo Island, Jeollanam-do, Korea Zj Zj Zj
304 Bigeumdo Island, Jeollanam-do, Korea H H H
305 Bigeumdo Island, Jeollanam-do, Korea Zj Zj Zj
306 Bigeumdo Island, Jeollanam-do, Korea Zj Zj Zj
307 Bigeumdo Island, Jeollanam-do, Korea H H H
308 Bigeumdo Island, Jeollanam-do, Korea Zj Zj Zj
309 Docho Island, Jeollanam-do, Korea Zj Zj Zj
310 Docho Island, Jeollanam-do, Korea Zs Zs Zs
311 Docho Island, Jeollanam-do, Korea Zs Zs Zs
312 Docho Island, Jeollanam-do, Korea Zj Zj -
313 Docho Island, Jeollanam-do, Korea H H -
314 Docho Island, Jeollanam-do, Korea H H H
315 Ulleungdo Island, Gyeongsangbuk-do, Korea H H H
317 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
318 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
319 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
320 Ulleungdo Island, Gyeongsangbuk-do, Korea H H H
321 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
322 Ulleungdo Island, Gyeongsangbuk-do, Korea H H H
324 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
325 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj -
326 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
327 Ulleungdo Island, Gyeongsangbuk-do, Korea H H H
328 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
329 Ulleungdo Island, Gyeongsangbuk-do, Korea H H H
330 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj -
331 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
333 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
334 Ulleungdo Island, Gyeongsangbuk-do, Korea Zj Zj Zj
335 Ulleungdo Island, Gyeongsangbuk-do, Korea H H H
336 Ulleungdo Island, Gyeongsangbuk-do, Korea H H H
338 Ulleungdo Island, Gyeongsangbuk-do, Korea H H -
339 Jindo Island, Jeollanam-do, Korea Zs Zs -
340 Jindo Island, Jeollanam-do, Korea H H H
341 Jindo Island, Jeollanam-do, Korea Zj Zj Zj
342 Jindo Island, Jeollanam-do, Korea Zs Zs Zs
344 Jindo Island, Jeollanam-do, Korea Zs Zs Zs
346 Jindo Island, Jeollanam-do, Korea Zj Zj Zj
348 Jindo Island, Jeollanam-do, Korea H H H
349 Jindo Island, Jeollanam-do, Korea H H H
355 Jindo Island, Jeollanam-do, Korea H H H
356 Jindo Island, Jeollanam-do, Korea H H H
357 Jindo Island, Jeollanam-do, Korea H H H
358 Jindo Island, Jeollanam-do, Korea Zj Zj Zj
359 Jindo Island, Jeollanam-do, Korea Zj Zj Zj
360 Jindo Island, Jeollanam-do, Korea H H H
363 Jindo Island, Jeollanam-do, Korea Zj Zj Zj
365 Jindo Island, Jeollanam-do, Korea Zs Zs -
367 Jindo Island, Jeollanam-do, Korea Zj Zj Zj
374 Seonyudo Island, Jeollabuk-do, Korea H H H
375 Seonyudo Island, Jeollabuk-do, Korea Zs Zs -
376 Seonyudo Island, Jeollabuk-do, Korea Zs Zs Zs
379 Seonyudo Island, Jeollabuk-do, Korea Zs Zs Zs
381 Seonyudo Island, Jeollabuk-do, Korea Zj - Zj
382 Seonyudo Island, Jeollabuk-do, Korea Zj Zj Zj
383 Chuja Island, Jeju, Korea Zj Zj Zj
385 Chuja Island, Jeju, Korea Zj Zj Zj
387 Chuja Island, Jeju, Korea H H H
388 Chuja Island, Jeju, Korea Zj Zj -
389 Chuja Island, Jeju, Korea Zj Zj Zj
390 Chuja Island, Jeju, Korea Zj - Zj
391 Chuja Island, Jeju, Korea Zj Zj Zj
392 Chuja Island, Jeju, Korea Zj Zj Zj
393 Chuja Island, Jeju, Korea Zj Zj Zj
394 Chuja Island, Jeju, Korea Zj Zj Zj
395 Chuja Island, Jeju, Korea Zj Zj -
397 Changseondo Island, Gyeongsangnam-do, Korea Zj Zj Zj
399 Changseondo Island, Gyeongsangnam-do, Korea Zj Zj Zj
401 Changseondo Island, Gyeongsangnam-do, Korea Zs Zs Zs
403 Changseondo Island, Gyeongsangnam-do, Korea Zj Zj -
404 Changseondo Island, Gyeongsangnam-do, Korea Zj Zj Zj
405 Changseondo Island, Gyeongsangnam-do, Korea H H H
406 Changseondo Island, Gyeongsangnam-do, Korea Zj - Zj
407 Changseondo Island, Gyeongsangnam-do, Korea Zs Zs Zs
409 Changseondo Island, Gyeongsangnam-do, Korea Zj Zj Zj
410 Changseondo Island, Gyeongsangnam-do, Korea Zj Zj Zj
411 Changseondo Island, Gyeongsangnam-do, Korea Zj Zj Zj
412 Changseondo Island, Gyeongsangnam-do, Korea Zj Zj Zj
413 Geojedo lsland, Gyeongsangnam-do, Korea Zj Zj Zj
414 Geojedo lsland, Gyeongsangnam-do, Korea H H H
415 Geojedo lsland, Gyeongsangnam-do, Korea Zj Zj -
416 Geojedo lsland, Gyeongsangnam-do, Korea Zs Zs Zs
418 Geojedo lsland, Gyeongsangnam-do, Korea Zj - Zj
419 Geojedo lsland, Gyeongsangnam-do, Korea Zj Zj Zj
420 Geojedo lsland, Gyeongsangnam-do, Korea H H H
421 Geojedo lsland, Gyeongsangnam-do, Korea H H H
423 Geojedo lsland, Gyeongsangnam-do, Korea Zj Zj Zj
424 Geojedo lsland, Gyeongsangnam-do, Korea Zj Zj Zj
425 Geojedo lsland, Gyeongsangnam-do, Korea Zj Zj Zj
427 Geojedo lsland, Gyeongsangnam-do, Korea Zj Zj Zj
428 Geojedo lsland, Gyeongsangnam-do, Korea Zj Zj -
429 Juwangsan, Gyeongsangbuk-do, Korea Zj Zj Zj
430 Juwangsan, Gyeongsangbuk-do, Korea H H H
431 Juwangsan, Gyeongsangbuk-do, Korea H H H
432 Juwangsan, Gyeongsangbuk-do, Korea Zj Zj Zj
433 Gayasan, Gyeongsangbuk-do, Korea Zj Zj Zj
434 Gayasan, Gyeongsangbuk-do, Korea Zj Zj Zj
436 Gyeryongsan, Chungcheongnam-do, Korea Zj Zj Zj
437 Gyeryongsan, Chungcheongnam-do, Korea Zj Zj Zj
438 Gyeryongsan, Chungcheongnam-do, Korea H H H
439 Gyeryongsan, Chungcheongnam-do, Korea Zj Zj Zj
440 Songnisan, Chungcheongbuk-do, Korea Zj Zj Zj
441 Naejangsan, Jeollabuk-do, Korea Zj Zj Zj
442 Naejangsan, Jeollabuk-do, Korea Zj Zj Zj
443 Naejangsan, Jeollabuk-do, Korea Zj Zj -
445 Naejangsan, Jeollabuk-do, Korea Zj Zj -
446 Naejangsan, Jeollabuk-do, Korea Zj - Zj
447 Sobaeksan, Chungcheongbuk-do, Korea H H -
448 Sobaeksan, Chungcheongbuk-do, Korea Zj Zj -
449 Woraksan, Chungcheongbuk-do, Korea Zj Zj -
450 Woraksan, Chungcheongbuk-do, Korea Zj Zj -
451 Woraksan, Chungcheongbuk-do, Korea Zj Zj -
452 Anmyeondo Island, Chungcheongnam-do, Korea Zs Zs -
453 Anmyeondo Island, Chungcheongnam-do, Korea Zs Zs -
455 Anmyeondo Island, Chungcheongnam-do, Korea Zj Zj Zj
456 Anmyeondo Island, Chungcheongnam-do, Korea H H H
457 Anmyeondo Island, Chungcheongnam-do, Korea H H H
458 Anmyeondo Island, Chungcheongnam-do, Korea H H H
459 Anmyeondo Island, Chungcheongnam-do, Korea H H H
460 Anmyeondo Island, Chungcheongnam-do, Korea H H H
461 Anmyeondo Island, Chungcheongnam-do, Korea H H H
462 Anmyeondo Island, Chungcheongnam-do, Korea Zj Zj Zj
464 Anmyeondo Island, Chungcheongnam-do, Korea Zj Zj Zj
466 Oeyeondo Island, Chungcheongnam-do, Korea H H H
467 Oeyeondo Island, Chungcheongnam-do, Korea Zj Zj Zj
468 Oeyeondo Island, Chungcheongnam-do, Korea H H -
469 Deokjeokdo Island, Gyeonggi-do, Korea Zs Zs -
470 Deokjeokdo Island, Gyeonggi-do, Korea Zs Zs -
471 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj -
472 Deokjeokdo Island, Gyeonggi-do, Korea Zs Zs Zs
473 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj -
474 Deokjeokdo Island, Gyeonggi-do, Korea H H H
476 Deokjeokdo Island, Gyeonggi-do, Korea H H -
477 Deokjeokdo Island, Gyeonggi-do, Korea H H -
478 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj Zj
479 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj Zj
480 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj Zj
481 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj Zj
482 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj Zj
483 Deokjeokdo Island, Gyeonggi-do, Korea H H -
484 Deokjeokdo Island, Gyeonggi-do, Korea H H -
485 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj Zj
486 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj -
487 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj -
488 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj -
489 Deokjeokdo Island, Gyeonggi-do, Korea Zj Zj -
490 Ganghwado Island, Gyeonggi-do, Korea H H -
491 Ganghwado Island, Gyeonggi-do, Korea Zs Zs Zs
492 Ganghwado Island, Gyeonggi-do, Korea H H H
493 Ganghwado Island, Gyeonggi-do, Korea Zj Zj -
494 Ganghwado Island, Gyeonggi-do, Korea Zs Zs -
495 Ganghwado Island, Gyeonggi-do, Korea H H -
496 Ganghwado Island, Gyeonggi-do, Korea H H -
498 Ganghwado Island, Gyeonggi-do, Korea H H -
499 Ganghwado Island, Gyeonggi-do, Korea Zj Zj -
500 Ganghwado Island, Gyeonggi-do, Korea Zj Zj Zj
501 Ganghwado Island, Gyeonggi-do, Korea H H -
502 Ganghwado Island, Gyeonggi-do, Korea H H -
503 Ganghwado Island, Gyeonggi-do, Korea Zj Zj Zj
505 Ganghwado Island, Gyeonggi-do, Korea Zj Zj Zj
506 Ganghwado Island, Gyeonggi-do, Korea Zj Zj Zj
507 Yeongjongdo Island, Gyeonggi-do, Korea Zj Zj Zj
508 Yeongjongdo Island, Gyeonggi-do, Korea H H H
509 Yeongjongdo Island, Gyeonggi-do, Korea Zj Zj Zj
510 Yeongjongdo Island, Gyeonggi-do, Korea H H H
511 Yeongjongdo Island, Gyeonggi-do, Korea H H H
512 Yeongjongdo Island, Gyeonggi-do, Korea H H H
513 Yeongjongdo Island, Gyeonggi-do, Korea Zj Zj Zj
514 Yeongjongdo Island, Gyeonggi-do, Korea H H -
515 Yeongjongdo Island, Gyeonggi-do, Korea H H -
516 Yeongjongdo Island, Gyeonggi-do, Korea H H -
517 Yeongjongdo Island, Gyeonggi-do, Korea Zj Zj -
518 Yeongheungdo Island, Gyeonggi-do, Korea Zj Zj -
519 Yeongheungdo Island, Gyeonggi-do, Korea H H -
520 Yeongheungdo Island, Gyeonggi-do, Korea H H -
521 Yeongheungdo Island, Gyeonggi-do, Korea Zj Zj -
522 Baekryeongdo Island, Gyeonggi-do, Korea Zs Zs -
523 Baekryeongdo Island, Gyeonggi-do, Korea Zs Zs -
524 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
525 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
526 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
527 Baekryeongdo Island, Gyeonggi-do, Korea H H H
528 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
529 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj -
530 Baekryeongdo Island, Gyeonggi-do, Korea H H -
531 Baekryeongdo Island, Gyeonggi-do, Korea H H -
532 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj -
533 Baekryeongdo Island, Gyeonggi-do, Korea H H -
534 Baekryeongdo Island, Gyeonggi-do, Korea H H H
535 Baekryeongdo Island, Gyeonggi-do, Korea H H H
536 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
537 Baekryeongdo Island, Gyeonggi-do, Korea H H H
538 Baekryeongdo Island, Gyeonggi-do, Korea H H H
539 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
540 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
541 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
542 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
543 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj Zj
545 Baekryeongdo Island, Gyeonggi-do, Korea H - H
546 Baekryeongdo Island, Gyeonggi-do, Korea H H H
547 Baekryeongdo Island, Gyeonggi-do, Korea Zj Zj -
548 Odaesan, Gangwon-do, Korea Zj Zj -
549 Seoraksan, Gangwon-do, Korea Zj Zj -
550 Chiaksan, Gangwon-do, Korea Zj Zj -
551 Chiaksan, Gangwon-do, Korea Zj Zj -
552 Chiaksan, Gangwon-do, Korea Zj Zj -
553 Chiaksan, Gangwon-do, Korea Zj Zj -
554 Bukhansan, Gyeonggi-do, Korea Zj Zj -
555 Bukhansan, Gyeonggi-do, Korea Zj Zj -
556 Bukhansan, Gyeonggi-do, Korea Zj Zj Zj
557 Bukhansan, Gyeonggi-do, Korea Zj Zj -
558 Bukhansan, Gyeonggi-do, Korea Zj Zj -
559 Bukhansan, Gyeonggi-do, Korea Zj Zj -
560 Bukhansan, Gyeonggi-do, Korea Zj Zj -
561 Biyangdo Island, Jeju, Korea Zs Zs Zs
562 Biyangdo Island, Jeju, Korea Zs Zs Zs
563 Biyangdo Island, Jeju, Korea Zj Zj Zj
564 Biyangdo Island, Jeju, Korea H H H
565 Biyangdo Island, Jeju, Korea H H H
566 Biyangdo Island, Jeju, Korea H H H
567 Biyangdo Island, Jeju, Korea H H H
570 Gosan, Jeju, Korea H H -
572 Gosan, Jeju, Korea Zs Zs -
573 Gosan, Jeju, Korea H H -
575 Wemi, Jeju, Korea Zs Zs -
576 Hallim, Jeju, Korea Zj Zj -
577 Gosan, Jeju, Korea H H -
1A Imported seed, China Zj Zj -
7D Hyeopje, Jeju, Korea Zj Zj -
6F Hadori, Jeju, Korea H H -
7F Hadori, Jeju, Korea H H -
7E Gosan, Jeju, Korea H H -
7A Dodu, Jeju, Korea Zj Zj -
9E Suncheon, Jeollanam-do, Korea Zj Zj -
7C Aphaedo Island, Jeollanam-do, Korea H H -

  잔디의 DNA 추출 및 ITS 기반 CAPS 마커 분석

분자생물학적 분류동정을 위하여 각 잔디로부터 DNA 추출은 GeneAll 회사의 ExgeneTM Plant SV Mini Kit(GeneAll, Korea)를 이용하여 추출하였으며, 추출한 DNA는 0.8% 겔의 전기영동으로 확인한 후 정량하여 PCR에 사용하였다. 이후 과정은 본 연구실에서 개발한 ITS 기반 CAPS 마커 분석(Hong et al., 2017)을 이용하였으나, 본 연구에서는 기존에 사용된 제한효소 중에서 가장 효율이 좋았던 Fau I를 사용하여 ITS 기반 CAPS 마커 분석되었으며, 간단한 방법은 다음과 같다. ITS 증폭을 위한 primer는 Gehrig et al.(2001)이 보고한 ITS1-forward primer(5’-TCCGTAGGTGAACCTGCGG-3’)와 ITS4-reverse primer(5’-TCCTCCGCTTATTGATATGC-3’)가 사용되었다. PCR은 AccuPower® PCR PreMix(Bioneer, Korea) 및 PCR Thermal Cycler Dice(TaKaRa, Japan)를 이용하였으며 95℃에서 5분간 전처리 후, 95°C에서 30초, 57°C에서 30초, 72°C에서 40초를 30회 반복한 후 72°C에서 10분간 후처리 하였다. 증폭된 686bp 및 687bp의 PCR 산물은 ExpinTM PCR SV Kit(GeneAll, Korea)를 이용하여 정제되였으며, 정제된 PCR 산물과 5 unit의 Fau I 제한효소(NEB, England), 10X CutSmart buffer가 포함된 14µL 반응액은 최적 반응 온도에서 충분한 시간 동안 반응시켰다. 최종 반응물은 2% agarose gel에서 전기영동 하여 CAPS marker 분석하였으며, 갯잔디(Zs)의 경우에 480bp, 들잔디(Zj)의 경우에 653bp, 들잔디와 갯잔디의 교잡종의 경우에 480bp, 653bp 부근에서 전기영동 주요 밴드를 확인하여 CAPS marker를 분석하여 분류 동정하였다.

  잔디의 TaqMan SNP genotyping assay 분석

각 잔디로부터 추출된 DNA는 TaqMan SNP genotyping assay 분석을 위한 재료로 사용되었다. TaqMan SNP Genotyping Assays를 수행하기 위하여 SNP는 대조구의 들잔디 및 갯잔디간의 ITS 염기서열의 567bp에 위치한 SNP(A 또는 G)의 유전자형을 Real-time PCR에 의해 확인하기 위하여 primer 와 probe로 구성된 SNP 유전자형 분석 세트(TaqMan Genotyping Master Mix)인 Forward primer(ACGGCACATGTTGTTCTTGGA)와 Reverse primer(CCTGAGGGCCATCATGTCA), Reporter 1 dye(VIC), Reporter 1 Sequence(TTGTGACCTGCATCGTAA), Reporter 1 Quencher(NFQ), Reporter 2 dye(FAM), Reporter 2 Sequence(TGTGACCTGCGTCGTAA), Reporter 2 Quencher(NFQ)를 제조하였다(TaqMan Genotyping Master Mix, Applied Biosystems, USA). 한국잔디류 유전자원들 각각 5–20ng/µL genomic DNA 1µL와 최종 1 X TaqMan Genotyping Master Mix(Applied Biosystems, USA), 1 X GoTaq Probe qPCR Master Mix(Promega, USA)를 혼합하여 96-well plate에 넣은 후 LightCycler 480 Real time PCR System(Roche, Swiss)기기를 이용하여 95°C 10분 1회, 95°C 15초 및 60°C 1분 40회 반복으로 LightCycler 480 Real time PCR System 기기의 분석프로그램 중에서 Endpoint Genotyping으로 TaqMan SNP Genotyping Assays 분석을 수행하였다. 대조구는 ITS 기반 CAPS 마커방법(Hong et al., 2017)으로 분자생물학적 분류동정이 이미 완료된 들잔디(Zj-C)의 판매 종자 및 수집된 갯잔디(Zs-C)종자, 들잔디와 갯잔디의 교잡종(H-C) 종자로부터 확보한 잔디를 분자생물학적 분류 동정의 대조구로 사용되었다(Fig. 1B and Table 1).

https://static.apub.kr/journalsite/sites/kshs/2023-041-04/N0130410411/images/HST_41_04_11_F1.jpg
Fig. 1.

Molecular identification of control zoysiagrass plants using ITS-based CAPS marker analysis (A), ITS-based TaqMan SNP genotyping assay (B): Analysis of the ITS-based CAPS marker and ITS-based TaqMan SNP genotyping assay allowed the classification of control zoysiagrass plants into Z. japonica plants (Zj-C, Zj), Z. sinica plants (Zs-C, Zs), and Z. japonica and Z. sinica hybrid plants (H-C, H); (A), ITS PCR products were purified and digested by Fau I; M is the size marker. (B), a three-cluster allelic discrimination plot generated with the TaqMan SNP genotyping assay.

  분자생물학적 식별된 한국잔디류의 서식환경별 분포 조사

분자생물학적 분류 동정된 한국잔디류 들잔디, 갯잔디 및 들잔디와 갯잔디의 교잡종에 대한 각 서식환경별 분포를 조사하였다. 분류 동정된 한국잔디류 450개체는 종별(들잔디, 갯잔디 및 들잔디와 갯잔디의 교잡종)로 분류하였고, 그 후에는 고지대(국립공원 산 및 오름) 및 저지대(내륙, 해안 및 섬)로 분류하여 각 종별 한국잔디류의 서식환경별 분포를 조사하였다.

한국잔디류 450개체의 지역은 강원도(오대산, 설악산, 치악산)의 산 3개, 경기도권(북한산, 백령도, 강화도, 영종도, 영흥도, 덕적도)의 산 1개 및 섬 5개, 충청북도(속리산, 소백산, 월악산)의 산 3개, 충청남도(계룡산, 안면도, 외연도)의 산 1개 및 섬 2개, 전라북도(지리산, 덕유산, 내장산, 고창, 선유도)의 산 3개, 내륙 및 해안가 1개, 섬 1개, 전라남도(월출산, 순천, 진도, 흑산도, 보길도, 안도, 금오도, 거금도, 고금도, 압해도, 자은도, 암태도, 안좌도, 팔금도, 비금도, 도초도)의 산 1개 및 해안 1개, 섬 14개, 경상북도(주왕산, 가야산, 울릉도)의 산 2개 및 섬 1개, 경상남도(창선도, 거제도)의 섬 2개, 제주도(신례, 효돈, 영평, 가시리, 안덕, 한라산 관음사, 한라산 성판악, 한라산 돈내코, 한라산 영실, 이승악(이승이오름), 대록산(큰사슴이오름), 거문오름, 백약이오름, 온평, 신양, 성산, 위미, 보목, 모슬포, 고산, 대정, 표선, 한림, 협제, 하도리, 도두, 가파도, 비양도, 추자도)의 내륙 5개, 산 및 오름 5개, 해안가 13개, 섬 3개이다(Table 1).

  분자생물학적 식별된 한국잔디 유전자원의 주요 외부형태적 특성인 엽폭 조사

한국잔디류의 외부형태학적으로 주요한 분류 형질인 잎의 너비(엽폭)는 들잔디, 갯잔디의 분류동정의 주요 형질로 이용되었다(Yang et al., 1995). 엽폭은 전자 자를 이용하여 3 반복으로 측정하였으며, 각 잔디 잎은 DNA 추출 재료로 사용되어 분자생물학적 ITS 기반 CAPS 마커 및 ITS 기반 TaqMan SNP genotyping assay 방법에 의하여 분류 동정되었다. 최종 분자생물학적으로 분류 동정된 들잔디, 갯잔디, 들잔디와 갯잔디의 교잡종은 외부형태학적 분류방법인 엽폭과 교잡종과의 상관관계를 비교 분석하였다.

결과 및 고찰

  수집된 대량의 한국잔디류 유전자원의 ITS 기반 CAPS 마커 분석과 ITS 기반 TaqMan SNP genotyping assay 분석에 의한 분자생물학적 잔디 식별

본 연구팀은 기존에 한국잔디류의 들잔디 및 갯잔디, 서양잔디류의 켄터키블루그라스 및 벤트그라스의 신속 정확하게 식별하기 위하여 분자생물학적 분류동정법으로 ITS 기반 DNA 바코드 분석 및 ITS 기반 CAPS 마커 분석(Hong et al., 2017)을 개발하였으며, 특히 해안가에서 자생하는 외부형태가 비슷하여 쉽게 식별이 어려웠던 한국잔디류의 들잔디 및 갯잔디, 들잔디와 갯잔디의 교잡종에서 ITS 기반 CAPS 마커 분석에 의하여 전기영동상 DNA 밴드 크기 차이로 정확한 분류 동정법을 개발하였다(Hong et al., 2017). 본 연구에서는 개발된 ITS 기반 CAPS 마커 분석을 활용하여 한국 전역(서울 및 인천을 포함하는 경기도권, 강원도, 충청남북도, 전라남북도, 경상남북도 지역의 내륙, 국립공원 산, 동 〮 서 〮 남해안 부근의 해안과 섬, 제주 지역의 오름 및 해안과 부속 섬 등)에서 다량 수집된 한국잔디류 영양체를 추가 분류동정 하였다(Fig. 1A). 수집된 한국잔디류 영양체 432개를 ITS 기반 CPAS 마커 분석법으로 분자생물학적 분류동정한 결과, 총 432개의 한국잔디류가 들잔디(Zj, J) 228개와 갯잔디(Zs, S) 52개, 들잔디와 갯잔디의 교잡종(H) 151개로 분류 동정되었다(Table 1, Figs. 1A and Fig. 2). 기존의 보고에서 ITS 기반 CPAS 마커 분석법 중에서 제한효소 Fau I으로 들잔디와 갯잔디, 교잡종을 분류 동정 수행할 경우, 2% agarose gel 전기영동상에서 들잔디의 경우에는 653bp와 33bp 중에서 653bp 크기의 절단된 DNA 조각의 주요 밴드 한 개, 갯잔디의 경우에는 480bp와 91bp 중에서 480bp 크기의 주요 밴드 한 개, 들잔디와 갯잔의 교잡종은 480bp, 653bp 부근에서 주요 밴드 두 개를 확인하여 분류 동정되었다(Hong et al., 2017)(Fig. 1A). 본 연구에서도 다량의 한국잔디류 영양체 432개의 ITS 기반 CAPS 마커 분석 결과 653bp의 들잔디(J), 480bp의 갯잔디(S), 480bp와 653bp의 들잔디와 갯잔디의 교잡종(H)으로 각각 절단된 DNA 주요 밴드가 확인되어 각각 들잔디, 갯잔디, 교잡종으로 추가 분류 동정되었다(Fig. 2).

https://static.apub.kr/journalsite/sites/kshs/2023-041-04/N0130410411/images/HST_41_04_11_F2.jpg
Fig. 2.

Molecular identification of collected zoysiagrass plants using the ITS-based CAPS marker analysis: Analysis of the ITS-based CAPS marker allowed the classification of the collected zoysiagrass plants into Z. japonica plants (J), Z. sinica plants (S), and Z. japonica and Z. sinica hybrid plants (H); M is the size marker; sample numbers are shown in Table 1.

ITS 기반 CAPS 마커 분석 방법은 들잔디, 갯잔디, 그들의 교잡종인 들잔디와 갯잔디를 정확하게 식별하였으나 대량 분석을 수행하는데 많은 시간과 노동력이 소요되었기 때문에, 본 연구에서는 좀 더 신속한 분자생물학적 분류 동정법인 ITS 기반 TaqMan SNP genotyping assay 분석 방법을 개발하여 대량 한국잔디류의 분류 동정을 수행하였다. ITS 기반 TaqMan SNP genotyping assay 분석에 의하여 대조구인 들잔디, 갯잔디, 들잔디와 갯잔디의 교잡종을 분류 동정한 결과, 대조구의 경우 들잔디(Zj)는 Y축에 가까이에 삼각형 모양의 점이 위치하였으며, 갯잔디(Zs)의 경우 X축, 들잔디와 갯잔디의 교잡종(H)의 경우 X축과 Y축 사이 45도 각도로 위치하여 분류 동정됨을 확인할 수 있었다(Fig. 1B). 이러한 결과를 바탕으로 대조구 및 대량 수집 한국잔디류 영양체 234개를 ITS 기반의 TaqMan SNP genotyping assay 분석한 결과, 총 234개의 한국잔디류가 들잔디(Zj) 124개와 갯잔디(Zs) 30개, 들잔디와 갯잔디의 교잡종(H) 80개로 분류 동정되었다(Tables 1, 2 and Fig. 3). 한국잔디류 영양체 234개 중에서 216개는 ITS 기반 CAPS 마커 분석 및 ITS 기반 TaqMan SNP genotyping assay 분석의 두 가지 방법으로 분류 동정되었으며, 그 결과는 두 가지 방법 모두 일치된 결과로 확인되어 본 연구에서 개발된 ITS 기반 TaqMan SNP genotyping assay 방법으로 들잔디(Zj), 갯잔디(Zs), 들잔디와 갯잔디의 교잡종(H)을 신속 정확하게 식별 가능함을 알 수 있었다(Table 1).

추가로 일부 잔디 제주 표선에서 수집된 125번, 전라남도 압해도 230번, 231번, 233번, 239번, 253번, 전라남도 암태도 274번, 276번, 전라남도 안좌도 284번, 285번, 286번, 전라남도 팔금도 296번, 전라북도 선유도 381, 제주 추자도 390번, 경상남도 창선도 406번, 경상남도 거제도 418번, 전라북도 내장산 446번, 경기도권 백령도 545번의 총 18개는 TaqMan SNP genotyping assay 분석만을 수행하여 신속하게 각각 들잔디 6개, 갯잔디 10개, 교잡종 2개로 분류 동정 되었다(Table 1, 2 and Fig. 3).

이러한 TaqMan probe 기술의 SNP genotyping assay 방법은 형광물질을 활용하여 genomic DNA 추출 및 TaqMan probe 이용한 ITS의 SNP 구간을 중심으로 Real-time PCR 증폭 후 전기영동 없이 컴퓨터 화면에서 그래프 및 표로 신속하게 종 분류 동정을 확인 할 수 있으며, 최근 SNP genotyping assay 기술은 생물종 식별, 유전변이 유무, 작물 육종과정에서 우수 계통의 선발 등의 중요한 분자표지 기술로 개발 및 활용되고 있다(Tan et al., 2017; Broccanello et al., 2018; Ayalew et al., 2019; Kang et al., 2020; Shin et al., 2020).

본 연구에서도 한국잔디류 들잔디, 갯잔디, 들잔디와 갯잔디의 교잡종 분류 동정 결과가 ITS 기반 CAPS 마커 분석과 ITS 기반의 TaqMan SNP genotyping assay 분석에서 결과가 일치하였으며, ITS 기반의 TaqMan SNP genotyping assay 분석법은 ITS 기반 CAPS 마커 분석법보다 신속하게 식별 가능함이 확인되었다.

  분자생물학적으로 식별된 들잔디, 갯잔디 및 교잡종 잔디의 서식환경별 분포 조사

ITS 기반 CAPS 마커 분석 및 ITS 기반 TaqMan SNP genotyping assay 분석을 이용하여 2012년부터 2018년도까지 한국 주요 지역의 각각 다른 위치에서 수집한 자생한국잔디류 약 620점(영양체 555점 및 종자 65점) 중 영양체 450점(개체)을 분석한 결과, 들잔디(Zj) 234개, 갯잔디(Zs) 62개 및 들잔디와 갯잔디의 교잡종(H) 154개로 분류 되었다(Tables 1, 2, and Figs. 1, 2, 3).

본 연구에서 분자생물학적으로 들잔디, 갯잔디 및 들잔디와 갯잔디의 교잡종으로 분류 동정된 잔디의 서식환경을 분석한 결과, 들잔디는 산 및 오름에서 총 71 개체 그리고 내륙 및 해안가 부근, 섬지역에서 총 135개체의 자생 들잔디가 분포하고 있음을 알 수 있었다(Table 1). 갯잔디는 주로 바닷물이 인접한 해수면 인근의 바위지대에서 분포하고 있으나, 고지대인 산 및 오름에는 갯잔디는 분포하지 않았다.

Table 2.

Molecular Identification of collected zoysiagrass plants using a three-cluster allelic discrimination plot generated with the TaqMan SNP Genotyping Assay: Molecular classification by endpoint fluorescence of Z. japonica plants (Zj), Z. sinica plants (Zs), and Z. japonica and Z. sinica hybrid plants (H). FAM or VIC dyes detect samples that are homozygous for allele X or allele Y, respectively; Allele X, allele Y, and both alleles indicate Zs, Zj, and H, respectively

No. Sample name
- Group (A)
Endpoint fluorescence Call
FAM
(465-510)
VIC
(533-580)
1 101 24.041 59.456 Allele Y
2 105 22.167 58.509 Allele Y
3 106 26.423 61.719 Allele Y
4 118 66.446 11.042 Allele X
5 119 67.329 8.697 Allele X
6 121 50.245 64.177 Both Alleles
7 125 32.375 70.271 Allele Y
8 131 35.695 76.242 Allele Y
9 138 36.853 74.619 Allele Y
10 142 34.161 73.859 Allele Y
11 145 25.184 64.525 Allele Y
12 146 37.76 76.975 Allele Y
13 159 24.77 61.944 Allele Y
14 165 37.896 47.712 Both Alleles
15 264 37.082 75.822 Allele Y
16 271 67.743 8.667 Allele X
17 272 38.068 74.89 Allele Y
18 273 35.369 74.757 Allele Y
19 283 37.472 76.381 Allele Y
20 284 66.066 9.408 Allele X
21 285 64.811 8.098 Allele X
22 286 25.829 2.466 Allele X
23 287 60.961 66.753 Both Alleles
24 270 56.309 60.374 Both Alleles
25 294 58.856 70.313 Both Alleles
26 295 58.113 70.396 Both Alleles
27 296 60.927 6.508 Allele X
28 297 51.021 66.39 Both Alleles
29 298 60.06 71.687 Both Alleles
30 301 54.26 73.833 Both Alleles
31 304 57.378 71.815 Both Alleles
32 305 41.193 77.731 Allele Y
33 306 38.135 76.503 Allele Y
34 307 66.435 58.802 Both Alleles
35 310 70.57 9.165 Allele X
36 311 73.939 12.461 Allele X
37 314 50.51 71.541 Both Alleles
38 324 34.453 73.036 Allele Y
39 326 39.289 75.842 Allele Y
40 334 36.12 76.743 Allele Y
41 335 58.213 67.331 Both Alleles
42 336 53.393 68.925 Both Alleles
43 342 70.892 10.124 Allele X
44 344 68.21 8.312 Allele X
45 346 36.649 78.944 Allele Y
46 348 59.082 75.439 Both Alleles
47 349 55.68 68.993 Both Alleles
48 356 55.955 75.961 Both Alleles
49 357 59.387 72.19 Both Alleles
50 374 58.311 61.031 Both Alleles
51 382 36.14 76.517 Allele Y
52 385 39.177 78.879 Allele Y
53 392 40.696 80.233 Allele Y
54 393 38.527 79.044 Allele Y
55 394 42.011 81.554 Allele Y
56 401 72.567 9.218 Allele X
57 409 40.352 80.36 Allele Y
58 410 40.461 77.863 Allele Y
59 411 37.281 74.58 Allele Y
60 412 41.999 80.676 Allele Y
61 413 37.742 77.419 Allele Y
62 414 60.555 69.381 Both Alleles
63 423 39.777 77.236 Allele Y
64 424 39.429 79.029 Allele Y
65 429 38.238 78.275 Allele Y
66 430 58.169 68.105 Both Alleles
67 431 55.38 60.714 Both Alleles
68 432 35.389 74.165 Allele Y
69 436 37.666 76.626 Allele Y
70 437 37.824 76.057 Allele Y
71 438 54.386 70.545 Both Alleles
72 439 37.829 76.625 Allele Y
73 440 37.418 74.271 Allele Y
74 441 38.991 74.52 Allele Y
75 442 35.173 71.083 Allele Y
76 455 29.927 69.665 Allele Y
77 456 52.949 65.298 Both Alleles
78 457 52.051 65.708 Both Alleles
79 466 52.684 64.066 Both Alleles
80 467 35.856 73.446 Allele Y
81 561 65.601 9.744 Allele X
82 562 65.295 9.638 Allele X
83 563 33.13 68.474 Allele Y
NC NC 2.53 3.145 Negative
NC NC 2.472 3.126 Negative
NC NC 0.154 0.159 Negative
H-C H-C 45.929 40.223 Both Alleles
Zj-C Zj-C 25.928 64.596 Allele Y
Zs-C Zs-C 49.547 6.051 Allele X
84 120 33.735 40.902 Both Alleles
85 134 25.2 56.666 Allele Y
86 231 51.501 4.726 Allele X
87 231 50.708 5.05 Allele X
88 232 38.39 47.437 Both Alleles
89 233 50.791 4.766 Allele X
90 233 53.922 5.639 Allele X
91 235 37.228 43.989 Both Alleles
92 236 42.745 4.618 Allele X
93 237 35.952 44.26 Both Alleles
94 239 33.645 39.024 Both Alleles
95 247 24.563 52.41 Allele Y
96 250 39.909 52.486 Both Alleles
97 251 40.944 52.404 Both Alleles
98 252 44.186 46.467 Both Alleles
99 253 39.437 4.071 Allele X
100 253 42.482 7.789 Allele X
101 263 18.222 46.366 Allele Y
102 274 37.704 4.154 Allele X
103 274 42.348 4.519 Allele X
104 275 43.139 51.396 Both Alleles
105 276 44.452 4.519 Allele X
106 276 52.441 4.673 Allele X
107 280 23.044 49.301 Allele Y
108 300 24.073 50.168 Allele Y
109 302 18.993 42.503 Allele Y
110 309 20.965 46.485 Allele Y
111 317 25.852 53.964 Allele Y
112 320 35.468 39.748 Both Alleles
113 321 19.014 42.34 Allele Y
114 328 21.242 45.371 Allele Y
115 328 20.159 41.693 Allele Y
116 329 34.195 40.234 Both Alleles
117 340 29.253 35.241 Both Alleles
118 358 20.92 43.367 Allele Y
119 358 22.773 48.865 Allele Y
120 359 25.796 52.533 Allele Y
121 360 36.659 43.218 Both Alleles
122 389 22.575 47.061 Allele Y
123 390 23.38 48.615 Allele Y
124 404 22.443 47.551 Allele Y
125 405 31.445 37.951 Both Alleles
126 406 22.164 46.325 Allele Y
127 427 1.285 4.996 Allele Y
128 458 33.255 36.627 Both Alleles
129 459 34.061 36.478 Both Alleles
130 460 34.191 41.138 Both Alleles
131 461 29.609 35.359 Both Alleles
132 464 24.136 51.903 Allele Y
133 466 40.898 48.475 Both Alleles
134 472 48.754 6.054 Allele X
135 474 37.386 45.341 Both Alleles
136 480 21.979 46.971 Allele Y
137 481 19.677 41.247 Allele Y
138 503 21.284 45.953 Allele Y
139 506 23.959 47.755 Allele Y
140 507 22.747 46.196 Allele Y
141 508 37.603 37.775 Both Alleles
142 511 33.087 37.346 Both Alleles
143 512 33.841 37.317 Both Alleles
144 524 23.142 46.864 Allele Y
145 526 22.55 44.937 Allele Y
146 528 22.194 44.633 Allele Y
147 534 29.797 33.932 Both Alleles
148 535 30.75 36.567 Both Alleles
149 537 33.047 37.961 Both Alleles
150 538 28.831 37.744 Both Alleles
151 540 20.852 41.405 Allele Y
152 541 21.957 45.041 Allele Y
153 543 21.123 41.793 Allele Y
154 545 29.062 37.669 Both Alleles
155 546 28.026 33.151 Both Alleles
156 556 19.01 38.051 Allele Y
157 269 28.95 36.169 Both Alleles
158 242 34.43 42.888 Both Alleles
159 573 21.088 44.148 Allele Y
160 308 22.126 45.042 Allele Y
161 341 21.514 43.957 Allele Y
162 462 20.43 43.199 Allele Y
163 482 20.65 44.053 Allele Y
164 513 20.037 40.949 Allele Y
NC NC 0.115 0.597 Negative
NC NC 0.022 0.48 Negative
H-C H-C 29.52 25.848 Both Alleles
Zj-C Zj-C 18.614 43.001 Allele Y
Zs-C Zs-C 40.18 5.257 Allele X
165 98 30.617 61.699 Allele Y
166 99 31.595 61.611 Allele Y
167 100 32.26 62.198 Allele Y
168 110 30.097 59.797 Allele Y
169 111 31.662 62.198 Allele Y
170 112 32.823 62.739 Allele Y
171 113 32.431 61.789 Allele Y
172 114 31.941 63.489 Allele Y
173 132 30.836 63.561 Allele Y
174 133 45.583 52.608 Both Alleles
175 145 29.755 61.582 Allele Y
176 166 49.172 55.833 Both Alleles
177 167 50.014 56.886 Both Alleles
178 168 33.854 64.775 Allele Y
179 178 31.204 62.324 Allele Y
180 189 32.154 64.135 Allele Y
181 193 49.71 57.195 Both Alleles
182 194 29.749 62.652 Allele Y
183 195 29.946 60.599 Allele Y
184 202 32.663 66.672 Allele Y
185 204 33.471 62.542 Allele Y
186 205 43.727 45.38 Both Alleles
187 206 34.939 40.623 Both Alleles
188 207 33.511 62.878 Allele Y
189 211 63.247 8.486 Allele X
190 215 32.454 61.916 Allele Y
191 216 50.377 55.064 Both Alleles
192 219 25.167 56.406 Allele Y
193 222 39.433 49.265 Both Alleles
194 224 49.758 55.493 Both Alleles
195 228 35.089 37.692 Both Alleles
196 230 61.64 7.055 Allele X
197 281 64.893 7.955 Allele X
198 299 60.916 8.392 Allele X
199 315 54.025 61.216 Both Alleles
200 318 30.878 62.731 Allele Y
201 319 33.328 65.771 Allele Y
202 322 54.411 56.891 Both Alleles
203 327 54.168 59.487 Both Alleles
204 331 33.731 65.894 Allele Y
205 333 27.338 62.103 Allele Y
206 355 38.798 36.751 Both Alleles
207 363 29.672 63.223 Allele Y
208 367 31.75 68.312 Allele Y
209 376 43.688 4.452 Allele X
210 379 41.32 3.934 Allele X
211 381 19.09 44.443 Allele Y
212 381 32.522 66.807 Allele Y
213 383 33.192 64.948 Allele Y
214 387 49.295 57.194 Both Alleles
215 391 18.621 43.678 Allele Y
216 397 35.062 67.697 Allele Y
217 399 31.311 64.726 Allele Y
218 407 39.531 4.767 Allele X
219 416 63.02 7.645 Allele X
220 418 31.934 66.207 Allele Y
221 419 28.06 64.15 Allele Y
222 420 35.026 39.071 Both Alleles
223 421 52.398 56.554 Both Alleles
224 425 32.476 66.115 Allele Y
225 433 20.044 48.642 Allele Y
226 434 34.05 66.39 Allele Y
227 446 19.844 45.467 Allele Y
228 478 31.404 64.682 Allele Y
229 479 31.299 64.454 Allele Y
230 485 30.422 63.552 Allele Y
231 491 64.103 7.463 Allele X
232 492 53.351 59.615 Both Alleles
233 500 32.378 65.359 Allele Y
234 505 33.025 65.754 Allele Y
235 509 31.428 65.646 Allele Y
236 510 48.705 55.808 Both Alleles
237 525 34.092 66.922 Allele Y
238 527 56.874 55.536 Both Alleles
239 536 33.304 65.139 Allele Y
240 539 34.53 65.584 Allele Y
241 542 34.519 68.793 Allele Y
242 564 54.31 39.638 Both Alleles
243 565 46.023 57.386 Both Alleles
244 566 51.094 52.319 Both Alleles
245 567 48.243 54.293 Both Alleles
NC NC 0.372 2.284 Negative
NC NC 0.029 0.099 Negative
NC NC 2.14 2.694 Negative
H-C H-C 33.915 27.872 Both Alleles
Zj-C Zj-C 25.354 57.678 Allele Y
Zs-C Zs-C 47.521 5.878 Allele X

https://static.apub.kr/journalsite/sites/kshs/2023-041-04/N0130410411/images/HST_41_04_11_F3.jpg
Fig. 3.

Molecular identification of collected zoysiagrass plants using a three-cluster allelic discrimination plot generated with the TaqMan SNP genotyping assay: Molecular classification of 234 samples of zoysiagrass plants (respective group A ~ C) as shown in Table 2 by endpoint fluorescence scatter plots (group A ~ C) of Z. japonica plants (Zj), Z. sinica plants (Zs), and Z. japonica and Z. sinica hybrid plants (H).

갯잔디는 저지대 중에서 섬지역 해안가 바닷물이 인접한 부근인 경기도권(백령도, 강화도, 덕적도)에서 7개, 충남(안면도)에서 2개체, 전라북도(선유도)에서 3개체, 전라남도(보길도, 거금도, 압해도, 자은도, 암태도, 안좌도, 팔금도, 비금도, 도초도, 진도)에서 30개체, 경상남도(거제도, 창선도) 3개체, 그리고 제주도(제주도 해안가 지역들, 비양도)에서 17개체가 수집되어 자생 갯잔디가 소량 분포하고 있었다(Table 1). 반면에 일부 섬지역인 경기도권의 영종도 및 영흥도, 충청남도 외연도, 전라남도 흑산도 및 안도, 금오도, 고금도, 경상북도 울릉도, 제주 가파도 및 추자도에서 본 연구팀이 외부형태적으로 갯잔디로 예상하여 수집했지만 모두 들잔디와 갯잔디의 교잡종으로 최종 분자생물학적 분류 동정되어 분자생물학적 갯잔디로 분류 동정된 잔디는 없었다(Table 1).

들잔디와 갯잔디의 교잡종은 아주 드물게 고지대인 소백산 및 계룡산, 지리산, 한라산 영실에서 총 4개체, 주왕산에서 총 2개체가 일부 인공적으로 조경이 되어있는 국립공원관리공단의 일부 탐방안내소, 등산로 및 절의 경내 인근에 확인되었다(Table 1). 또한, 수집된 모든 섬 지역에서 자생 들잔디와 갯잔디의 교잡종이 총 114개체가 확인되었고, 국립공원 산 보다는 내륙 및 해안가, 섬지역에 걸쳐 다양한 장소에 분포하고 있음을 알 수 있었다(Table 1). 한국잔디류의 FT-IR 대사체 분석에 의하여 식별된 들잔디 및 갯잔디 계통에서 들잔디는 고지대 국립공원 산에서, 갯잔디는 저지대 해안가에서 주로 분포하였으며(Yang et al., 2016b), 들잔디는 내륙부터 해안까지 넓은 범위로 분포되어 있으나 갯잔디와 그들의 교잡종은 서해안 및 남해안, 도서지역 부근에 분포하고 있다고 보고되었다(Choi, 2017).

한국잔디류는 주로 타가수정하여 가까운 거리에서 분포하고 있는 들잔디 및 갯잔디의 경우 자연적으로 종간 교잡되기 때문에(Choi et al., 2008; Choi, 2017), 갯잔디가 자생하지 않는 고지대의 국립공원 산 및 오름 보다는 저지대의 해안가 및 내륙에서 들잔디와 갯잔디가 자연적으로 종간 교잡된 것으로 추정된다. 본 연구에서도 분자생물학적으로 분류 동정한 수집된 들잔디는 주로 국립공원 산 및 오름, 내륙, 해안가 부근에서 분포되었고, 갯잔디는 바닷물에 자주 잠기는 바위나 돌, 해안가의 바닷물이 인접한 부근에서 분포되었으며, 들잔디와 갯잔디의 교잡종은 국립공원 산 및 오름보다 내륙 및 해안가, 섬지역에 걸쳐 다양한 장소에 분포되어 기존의 보고와 유사하였다.

  분자생물학적으로 식별된 들잔디, 갯잔디, 들잔디와 갯잔디의 교잡종의 잎의 너비 분석

들잔디 및 갯잔디 등 한국잔디류의 외부형태적 주요 분류동정법으로는 육안으로 쉽게 관찰 가능한 엽폭 크기 등이 활용되고 있다(Hong and Yeam, 1985; Yang et al., 1995; Choi et al., 1997; Bae et al., 2010; Lee et al., 2013; Yang et al., 2021a, 2021b). 최종 분자생물학적으로 분류 동정된 들잔디, 갯잔디, 들잔디와 갯잔디의 교잡종을 대상으로 기존 외부형태학적으로 주요한 분류 형질인 엽폭이 교잡종의 분류동정에 이용할 수 있는지 분석하였다. 분자생물학적 분류 동정된 들잔디(Zj) 234개, 갯잔디(Zs) 62개, 들잔디와 갯잔디의 교잡종(H) 154개의 한국잔디류 총 450개의 각 종별 엽폭 평균은 들잔디의 경우 4.52 ± 0.05mm, 갯잔디의 경우 2.97 ± 0.07mm, 들잔디와 갯잔디의 교잡종의 경우 3.51 ± 0.05mm로 분석되었다(Table 3). 들잔디의 엽폭 평균은 갯잔디보다 약 1.5배 넓고 들잔디와 갯잔디의 교잡종 보다 약 1.3배 넓게 분석되었으며, 갯잔디는 들잔디와 갯잔디의 교잡종 보다 약 1.2배 좁게 분석되어, 들잔디와 갯잔디의 교잡종은 들잔디와 갯잔디의 중간값을 보였다(Table 3).

Table 3.

Leaf blade width as a main external morphological classification characteristic of the molecularly identified Z. japonica plants (Zj), Z. sinica plants (Zs), and Z. japonica and Z. sinica hybrid plants (H)

Sample Species Leaf blade width (mm)
Z. japonica (Zj) 4.52 ± 0.05
Z. japonica and Z. sinica hybrid (H) 3.51 ± 0.05
Z. sinica (Zs) 2.97 ± 0.07

The results represent the means±SE of values obtained from three experiments.

각 종별로 엽폭 크기의 범위를 조사하기 위하여, 총 450개체의 한국잔디류는 각 종에서 엽폭 크기(0.5–2.0, 2.001–3.0, 3.001–4.0, 4.001–5.0, 5.001–6.0, 6.001–7.0mm)별로 잔디 개수를 확인하였다. 그 결과, 들잔디의 경우에는 2.001–7.0mm로 다양한 크기의 엽폭을 확인 할 수 있었으며 특히 들잔디(Zj) 234개체 중에서 131개체의 엽폭 크기가 4.001–5.0mm로 가장 많았으며, 2.001–3.0mm와 6.001–7.0mm의 13개체를 제외한 대부분의 들잔디 221개체의 엽폭 크기가 3.001–6.0mm의 범위임을 알 수 있었다(Fig. 4).

https://static.apub.kr/journalsite/sites/kshs/2023-041-04/N0130410411/images/HST_41_04_11_F4.jpg
Fig. 4.

Number of zoysiagrasses according to the leaf blade width of each plant identified by molecular techniques as Z. japonica plants (Zj), Z. sinica plants (Zs), and Z. japonica and Z. sinica hybrid plants (H).

갯잔디(Zs) 62개체의 엽폭 크기는 0.5–5.0mm의 다양한 범위로 2.001–3.0mm에서 33개체, 3.001–4.0mm에서 26개체이며, 대체로 갯잔디의 엽폭 크기가 2.001–4.0mm의 범위로 들잔디 보다 작은 엽폭 크기의 범위임을 알 수 있었다(Fig. 4).

들잔디와 갯잔디의 교잡종(H) 154개체의 엽폭 크기는 0.5–6.0mm으로 갯잔디 보다 범위가 큰 다양한 범위이며, 엽폭 크기가 3.001–4.0mm에서 99개체로 가장 많았으며 2.001–3.0mm과 4.001–5.0mm에서 총 51개체의 잔디들도 확인 되어, 4개체를 제외한 150개체의 엽폭 크기가 대체로 2.001–5.0mm의 범위로 나타났다(Fig. 4).

기존의 보고에서 들잔디와 갯잔디 등의 한국잔디류의 엽폭, 종자길이 및 종자 폭의 특성은 유전적 주요 형질을 반영하고 있으며 환경적으로 영향을 적게 받아 종의 분류 동정하는데 매우 유용한 형질로 판단되며, 잎의 길이(엽신 길이), 화서 길이, 화수 길이 및 화수당 종자 수 등의 특성은 한국잔디류 종 분류 동정하는데 주요한 필수 형질로 보기 어렵다고 보고하였다(Hong and Yeam, 1985; Yang et al., 1995; Choi et al., 1997; Bae et al., 2010; Lee et al., 2013). 한국잔디류는 봄 또는 여름에 종자가 맺혀 종자를 관찰하는데 시간적 제약이 있기 때문에, 항상 관찰이 가능한 엽폭 크기를 이용하여 주로 분류 동정해 왔다(Hong and Yeam, 1985; Yang et al., 1995; Choi et al., 1997; Bae et al., 2010; Lee et al., 2013; Yang et al., 2021a, 2021b).

본 연구에서는 분자생물학적으로 분류 동정된 들잔디, 갯잔디, 들잔디와 갯잔디의 교잡종의 엽폭 크기의 범위가 대체로 들잔디(Zj)의 경우 4–5mm, 갯잔디(Zs)의 경우 2–4mm, 들잔디와 갯잔디의 교잡종(H)의 경우 3–4mm로 분석되었다(Fig. 4). 그러나, 일부 들잔디의 6개체들(2–3mm)과 갯잔디 2개체들(4–5mm), 들잔디와 갯잔디의 교잡종의 51개체들(2–3mm과 4–5mm)이 존재하며, 이러한 각 종별 엽폭의 크기는 서로 겹치는 범위가 있기 때문에 외부형태학적 주요 특성인 엽폭 크기는 들잔디와 갯잔디의 교잡종을 확실히 분류 동정하기에 쉽지 않음을 확인할 수 있었다(Fig. 4). 다양한 장소에서 수집 보존중인 한국잔디류의 경우, 확연히 다른 환경인 고지대의 국립공원 산에서 수집된 들잔디나 갯벌 또는 바닷물이 인접한 바닷가 바위에서 수집된 갯잔디들은 외부형태학적인 명확한 차이 때문에 종 분류 동정은 쉽게 가능하다. 그러나, 해안가와 섬지역 같은 바다와 가까운 환경에서 수집된 들잔디, 갯잔디 및 들잔디와 갯잔디의 교잡종은 외형이 유사하여 외부형태학적 분류동정이 쉽지 않기 때문에(Yang et al., 1995; Hong et al., 2017), 신속정확한 분자생물학적 분류 동정법이 요구됨을 알 수 있었다.

본 연구에서는 기존에 본 연구팀에서 확립한 ITS 기반 CAPS 마커를 활용하여 한국 주요 지역에서 수집하여 보존 중인 다량의 한국잔디류 유전자원을 추가 분류동정 하였으며, ITS 기반 TaqMan SNP genotyping assay 분석법을 개발하여 좀 더 신속 정확하게 분자생물학적으로 다량의 한국잔디류를 분류동정 하였다. 또한 분자생물학적 분류동정된 들잔디, 갯잔디 및 교잡종의 서식환경별 분포를 조사하였으며, 주요 외부형태적 분류 특성인 엽폭을 조사하여 각 종들과 비교 분석하여 분자생물학적 분류 동정법의 적용 가능성을 제시하였다. 본 연구에서 최종 개발된 분자생물학적 분류 동정법을 이용하면 우리나라에 자생하는 들잔디, 갯잔디 및 들잔디와 갯잔디의 교잡종의 유용 형질의 유전자원을 신속하게 식별하여 유전자원 보존 및 관리, 교잡육종 및 유용 신품종 개발 시 계통분석에 활용될 수 있을 것으로 기대된다.

Acknowledgements

본 논문은 산림청 국립산림품종관리센터 산림생명자원관리기관사업 및 정부(교육부)의 재원으로 한국연구재단의 지원을 받아 수행된 기초연구사업임(No. 2019R1A6A1A11052070).

References

1
Ahn SY, Cho KS, Yoo KO, Suh JT (2010) Phylogenetic relationship of Ligularia species based on RAPD and ITS sequence analysis. Kor J Hortic Sci Technol 28:638-647
2
Ayalew H, Tsang PW, Chu C, Wang J, Liu S, Chen C, Ma XF (2019) Comparison of TaqMan, KASP and rhAmp SNP genotyping platforms in hexaploid wheat. PloS one 14:e0217222. doi:10.1371/journal.pone.0217222 10.1371/journal.pone.021722231116793PMC6530864
3
Bae EJ, Lee KS, Kim DS, Han EH, Lee SM, Lee DW (2013) Sod production and current status of cultivation management in Korea. Weed Turf Sci 2:95-99. doi:10.5660/WTS.2013.2.1.095 10.5660/WTS.2013.2.1.095
4
Bae EJ, Park NC, Lee KS, Lee SM, Choi JS, Yang GM (2010) Distribution and morphology characteristics of native zoysiagrasses (Zoysia spp.) grown in South Korea. Kor Turfgrass Sci 24:97-105
5
Baigalmaa J, Kim MK, Noh JH, Hua S, Yang DC (2009) Phylogenetic analysis of Schizonepeta Spike on the basis of DNA sequences. K J Med Crop Sci 17:46-53
6
Broccanello C, Chiodi C, Funk A, McGrath JM, Panella L, Stevanato P (2018) Comparison of three PCR-based assays for SNP genotyping in plants. Plant Methods 14:28. doi:10.1186/s13007-018-0295-6 10.1186/s13007-018-0295-629610576PMC5872507
7
CBOL Plant Working Group (2009) A DNA barcode for land plants. Proc Natl Acad Sci USA 106:12794-12797. doi:10.1073/pnas.0905845106 10.1073/pnas.090584510619666622PMC2722355
8
China Plant BOL Group (2011) Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. Proc Natl Acad Sci USA 108:19641-19646. doi:10.1073/pnas.1104551108 10.1073/pnas.110455110822100737PMC3241788
9
Choi DK, Yang GM, Choi JS (2008) Flowering periods, genetic characteristics, and cross-pollination rate of Zoysia spp in natural open-pollination. Kor Turfgrass Sci 22:13-24
10
Choi JS (2017) Distribution, classification, breeding, and current use of zoysiagrass species and cultivars in Korea. Weed Turf Sci 6:283-291
11
Choi JS, Ahn BJ, Yang GM (1997) Distribution of native Zoysiagrasses (Zoysia spp.) in the south and west coastal regions of Korea and classification using morphological characteristics. J Kor Soc Hort Sci 38:399-407
12
Choi JS, Yang GM (2004) Development of new hybrid cultivar 'Senock' in zoysiagrass. Kor Tufgrass Sci 18:201-209
13
Choi JS, Yang GM (2006a) Sod production in South Korea. Kor Turfgrass Sci 20:237-251
14
Choi JS, Yang GM (2006b) Development of new cultivar 'Millock' in zoysiagrass. Kor. Tufgrass Sci 20:1-10
15
Choi JS, Yang GM, Oh CJ, Lee GJ, Bae EJ, Lee KS (2018) Development of New Cultivars 'JangsungChorok' and 'JangsungSaetbyeol' in Zoysiagrass. Weed Turf Sci 7:231-238
16
Chung SJ, Park SJ, Choi YI, Kim IK, Lee KY, Kim HJ, Lee GJ (2013) SCAR markers were developed to identify zoysiagrass mutants exhibiting fine leaf characteristics. CNU J of Agri Sci 40:115-121. doi:10.7744/cnujas.2013.40.2.115 10.7744/cnujas.2013.40.2.115
17
Gao T, Yao H, Song J, Liu C, Zhu Y, MA X, Pang X, Xu H, Chen S (2010) Identification of medicinal plants in the family Fabaceae using a potential DNA barcode ITS 2. J Ethnopharmacol 130:116-121. doi:10.1016/j.jep.2010.04.026 10.1016/j.jep.2010.04.02620435122
18
Gehrig H, Gauβmann O, Marx H, Schwarzott D, Kluge M (2001) Molecular phylogeny of the genus Kalanchoe (Crassulaceae) inferred from nucleotide sequences of the ITS-1 and ITS-2 regions. Plant Sci 160:827-835. doi:10.1016/S0168-9452(00)00447-7 10.1016/S0168-9452(00)00447-711297779
19
Han HS, Kim DY, Lee KY, Park WG, Cho IK, Jung JS (2006) Comparative analysis of Acanthopanax senticosus Harms from Korea, China and Russia Based on the ITS sequences of nuclear ribosomal DNA. Korean J Plant Res 19:54-58
20
Hebert PDN, Cywinska A, Ball SL, Waard JR de (2003) Biological identifications through DNA barcodes. Proc R Soc Lond B 270:313-321. doi:10.1098/rspb.2002.2218 10.1098/rspb.2002.221812614582PMC1691236
21
Hong GH, Yeam DY (1985) Studies on Interspecific Hybridization in Korean Lawngrasses (Zoysia spp.) Hortic Sci Technol 26:169-178
22
Hong MJ, Yang DH, Jeong OC, Kim YJ, Park MY, Kang HG, Sun HJ, Kwon YI, Park SY, et al. (2017) Molecular identification of Zoysia japonica and Zoysia sinica (Zoysia Species) based on ITS sequence analyses and CAPS. Hortic Sci Technol 35:344-360. doi:10.12972/kjhst.20170037 10.12972/kjhst.20170037
23
Hong SY, Cho KS, Yoo KO (2012) Phylogenetic analysis of Korean native aster plants based on internal transcribed spacer (ITS) sequence. Kor J Hort Sci Technol 30:178-184. doi:10.7235/hort.2012.11139 10.7235/hort.2012.11139
24
Hyun YH, Choi BJ, Kim YJ, Joo YK (2012) Analysis of research trend on zoysiagrass (Zoysia spp). Asian J Turfgrass Sci 26:89-95
25
Kang J, Lee S, Lee J, Kwon Y, Lee S, Kabange N, Shin D, Cha J, Park D, Ko J (2020) Development and validation of KASP markers for Stv-bi, a rice stripe virus resistance gene in rice (Oryza sativa L.). Plant Breed Biotech 8:196-201. doi:10.9787/PBB.2020.8.2.196 10.9787/PBB.2020.8.2.196
26
Kim HJ, Lee HR, Hyun JY, Won DC, Hong DO, Harn CH (2012) CAPS marker linked to tomato hypocotyl pigmentation. Kor J Hortic Sci Technol 30:56-63. doi:10.7235/hort.2012.11069 10.7235/hort.2012.11069
27
Kim HK, Lee SJ (2010) Turfgrass and golf course. Sunjinmunhwa Publishing 99-180
28
Kim SJ, Cho KS, Yoo KO, Lim KB, Hwang YJ, Chang DC, Kim KS (2015) Sequence analysis of the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA (nrDNA) Chrysanthemum species in Korea. Hortic Environ Biotechnol 56:44-53. doi:10.1007/s13580-015-0085-2 10.1007/s13580-015-0085-2
29
Koch H (2010) Combining morphology and DNA barcoding resolves the taxonomy of Western Malagasy Liotrigona Moure, 1961. African Invertebrates 51:413-421. doi:10.5733/afin.051.0210 10.5733/afin.051.0210
30
Kress WJ, Erickson DL (2008) DNA barcodes: genes, genomics, and bioinformatics. Proc Natl Acad Sci USA 105:2761-2762. doi:10.1073/pnas.0800476105 10.1073/pnas.080047610518287050PMC2268532
31
Kress WJ, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DH (2005) Use of DNA barcodes to identify flowering plants. Proc Natl Acad Sci USA 102:8369-8374. doi:10.1073/pnas.0503123102 10.1073/pnas.050312310215928076PMC1142120
32
Kunihisa M, Fukino N, Matsumoto S (2003) Development of cleavage amplified polymorphic sequence (CAPS) markers for identification of strawberry cultivars. Euphytica 134:209-215. doi:10.1023/B:EUPH.0000003884.19248.33 10.1023/B:EUPH.0000003884.19248.33
33
Lee S, Yu HC, Yoon BS, Yang GM, Kim JY, Kim Y, Oh CJ (2013) Soil and morphological characteristics of native zoysiagrasses by the habitats. Weed Turf Sci 2:55-61. doi:10.5660/WTS.2013.2.1.055 10.5660/WTS.2013.2.1.055
34
Li RF, Wei JH, Wang HZ, He J, Sun ZY (2006) Development of highly regenerable callus lines and Agrobacterium-mediated transformation of Chinese lawngrass (Zoysia sinica Hance) with a cold inducible transcription factor, CBF1. Plant Cell Tiss Org 85:297-305. doi:10.1007/s11240-006-9080-8 10.1007/s11240-006-9080-8
35
Moon BC, Lee YM, Ji Y, Choi G, Chun JM, Kim HK (2013) Molecular Authentication and Phylogenetic Analysis of Plant Species for Breeae and Cirsii Herba based on DNA barcodes. Kor J Herbology 28:75-84. doi:10.6116/kjh.2013.28.3.75 10.6116/kjh.2013.28.3.75
36
Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15:473-497. doi:10.1111/j.1399-3054.1962.tb08052.x 10.1111/j.1399-3054.1962.tb08052.x
37
Shin DJ, Cha JK, Lee SM, Ko JM, Lee JH (2020) Validation and selection of functional allele-specific molecular markers to analyze high-molecular-weight glutenin subunit composition in wheat. Korean J Breed Sci 52:235-243. doi:10.9787/KJBS.2020.52.3.235 10.9787/KJBS.2020.52.3.235
38
Song IJ, Sun HJ, Jeong OC, Yang DH, Jin ID, Kang HG, Ko SM, Kwon YI, Bae TW, et al. (2017) Development of Dwarf Type Cultivar 'Halla Green 2' in Zoysia japonica Steud. Korean J Breed Sci 49:31-35. doi:10.9787/KJBS.2017.49.1.31 10.9787/KJBS.2017.49.1.31
39
Sun HJ, Song IJ, Bae TW, Lee HY (2010) Recent development in biotechnological improvement of Zoysia japonica Steud. J Plant Biotechnol 37:400-407. doi:10.5010/JPB.2010.37.4.400 10.5010/JPB.2010.37.4.400
40
Tan CT, YuH, Yang Y, Xu X, Chen M, Rudd JC, Xue Q, Ibrahim AM, Garza L, Wang S (2017) Development and validation of KASP markers for the greenbug resistance gene Gb7 and the Hessian fly resistance gene H32 in wheat. Theor Appl Genet 130:1867-1884. doi:10.1007/s00122-017-2930-4 10.1007/s00122-017-2930-428624908
41
Yang DH, Sun HJ, Jeong OC, Song IJ, Bae TW, Jin ID, Kang HG, Ko SM, Kwon YI, et al.(2016a) Dwarf Zoysiagrass (Zoysia japonica) Cultivar 'Halla Green 1' Developed Through Mutation Breeding. Korean J Breed Sci 48:516-520. doi:10.9787/KJBS.2016.48.4.516 10.9787/KJBS.2016.48.4.516
42
Yang DH, Ahn MS, Jeong OC, Song IJ, Ko SM, Jeon YI, Kang HG, Sun HJ, Kwon YI, et al. (2016b) Rapid metabolic discrimination between Zoysia japonica and Zoysia sinica based on multivariate analysis of FT-IR spectroscopy. J Plant Biotechnol 43:213-222. doi:10.5010/JPB.2016.43.2.213 10.5010/JPB.2016.43.2.213
43
Yang DH, Sun HJ, Jeong OC, Kang HG, Song IJ, Jin ID, Kang SY, Lee HY (2021a) Development of 'Halla Green 7': a zoysiagrass cultivar with greening period extending phenotype at lower temperatures. Korean J Breed Sci 53:458-466. doi:10.9787/KJBS.2021.53.4.458 10.9787/KJBS.2021.53.4.458
44
Yang DH, Jeong OC, Sun HJ, Kang HG, Jin ID, Lee HY (2021b) Development of 'Halla Green 10' in zoysiagrass. Korean J Breed Sci 53:467-474. doi:10.9787/KJBS.2021.53.4.467 10.9787/KJBS.2021.53.4.467
45
Yang GM, Ahn BJ, Choi JS (1995) Identification of native zoysiagrasses (Zoysia spp) using morphological characteristics and esterase isozymes. J Kor Soc Hortic Sci 36:240-247
46
Yao H, Song J, Liu C, Luo K, Han J, Li Y, Pang X, Xu H, Zhu Y, Xiao P, Chen S (2010) Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS ONE 5:e13102. doi:10.1371/journal.pone.0013102 10.1371/journal.pone.001310220957043PMC2948509
47
Yu TY, Yeam DY, Kim YJ, Kim SJ (1974) Morphological studies on Korean lawn grasses (Zoysia spp). J Kor Soc Hort Sci 15:79-91
페이지 상단으로 이동하기