Research Article

Horticultural Science and Technology. 28 February 2025. 33-60
https://doi.org/10.7235/HORT.20250009

ABSTRACT


MAIN

  • Introduction

  • Materials and Methods

  • Myrtaceae extracts preparation

  • Identification of Alternaria species by sequence analysis

  • Preliminary phytochemical screening of leaf extracts from four Myrtaceae plants

  • Phytotoxicity of four Myrtaceae extracts on lettuce grown in hydroponics

  • In vitro antifungal activity of Myrtaceae extracts on the growth of Alternaria sp.

  • GC/MS and LC/MC-TOF analyses of the Myrtaceae extracts

  • Evaluation of EEMC and EECV as an inducer on development of Alternaria leaf spot and the induction of defense enzymes in lettuce grown in a hydroponic system

  • Results and Discussion

  • Identification of Alternaria species by sequence analysis

  • Phytochemical screening of four Myrtaceae leaf extracts

  • Phytotoxicity of four Myrtaceae extracts on lettuce grown in hydroponics

  • In vitro antifungal activity of Myrtaceae extracts against growth of Alternaria sp.

  • Phytochemical profile of the Myrtaceae extracts by GC/MS and LC/MC-TOF

  • Evaluation of EEMC and EECV as an inducer on development of Alternaria leaf spot and induction of defense enzymes in lettuce grown in a hydroponic system

  • Conclusion

Introduction

For leafy vegetable production, synthetic fungicides have been widely employed to combat foliar diseases, including Alternaria leaf spot. However, the use of chemical fungicides is increasingly restricted due to concerns about food safety, particularly within organic farming practices (Horsfield et al. 2010; Wang et al. 2016; Yang et al. 2019; Wu et al. 2023). Hence, a transfer from synthetic to natural safe fungicide is needed. Plant extracts are of great significance in this regard. Scientific studies have been carried out worldwide on the antifungal activities of plant extracts against the fungal pathogens of plant diseases, which have resulted in the development of promising sources of natural fungicides and botanical fungicides offering a potential solution to agricultural challenges (Jantasorn et al. 2016; Dethoup et al. 2018; Dethoup et al. 2019; Sukdee 2023). In general, plant extracts have secondary metabolites (e.g., phenolics, phenolic acids, terpenoids, essential oils, alkaloids, tannins, flavonoids, coumarins, lectins and polypeptide) which represent biologically active substances (Gurjar et al. 2012; Pinto et al. 2018). Several researchers have uncovered the potential of medicinal plants to control plant pathogens, both by direct fungal toxic actions and due to the ability to stimulate the accumulation of molecules with elicitor features capable of inducing defense responses (Bonaldo et al. 2004; Celoto et al. 2008; Bulhões et al. 2012; Pinto et al. 2018). These resistance mechanisms may include the accumulation of phenolic compounds, phytoalexins and pathogenesis-related proteins such as β-1,3-glucanase, chitinase, peroxidase, phenylalanine ammonia lyase and polyphenol oxidase (Barros et al. 2010). Plant extract enhancers of the defense response in Ponkan mandarin seedlings against Alternaria alternata f. spp. citri infection were reported by Pinto et al. (2018). In 2012, Gurjar et al. reviewed the efficacy of plant extracts in plant disease management, finding that thousands of phytochemicals with inhibitory effects on all types of microorganisms in vitro should be subjected to in vivo testing to evaluate how well they control the incidence of disease in crops. The latest studies of natural alternatives for chemical synthetic pesticides, including the application of neem extract to manage postharvest losses due to postharvest diseases (e.g., Aspergillus flavus, A. niger and Botrytis cinerea) of fresh produce in tropical and subtropical fruits, were reviewed by Tzortzakis and Proestos (2024). In Thailand, the popularity of botanical fungicides is also increasing. Quite a number of phytochemical extracts have been evaluated during the search for plant-based antifungal agents for plant disease management, some recently reported studies include those on indigenous plants, such as Hydnocarpus anthelminthicus, Crateva magna, Caesalpinia sappan (Jantasorn et al. 2016), Acorus calamus (Dethoup et al. 2019) and black pepper (Kunasakdakul and Suwitchayanon 2012).

Myrtaceae plants, specifically Callistemon viminalis, Melaleuca cajuputi, Syzygium jambos, and Syzygium malaccense, are naturally found in Australia, southeast Asian countries, including Thailand, Malaysia and Indonesia (Bharat and Praveen 2016; Salem et al. 2017; Patel et al. 2019; Isah et al. 2023). Various plant species from the Myrtaceae family have long been widely used for medicinal purposes given their antimicrobial, anti-inflammatory and antioxidant activities (Imatomi et al. 2013; Al-Abd et al. 2015; Rita et al. 2017; Salem et al. 2017; Puig et al. 2018; Patel et al. 2019; Vasconcelos et al. 2022). The phytochemical extract of C. viminalis demonstrated strong to moderate antibacterial effects against certain plant bacterial pathogens (El-Hefny et al. 2017) as well as in vitro antifungal effects (Somnuek et al. 2020; Somnuek et al. 2021). Essential oil extracted from M. cajuputi has been widely used worldwide for many purposes. Most of the compounds found in this plant possess aromatic, antibacterial and insecticide properties (Sharif et al. 2019). Keereedach et al. (2020) reported that Thai cajuput oil can be used to create new potential combination therapies to combat the antifungal resistance of Candida albicans. In addition, several studies have found the excellent antimicrobial effects of M. cajuputi extracts against bacteria, viruses, protozoa and fungal species due to the presence of specific phytoconstituents (Isah et al. 2023). S. jambos extract showed antimicrobial activity on the growth of both gram-positive and gram-negative bacteria (Mohanty and Cock 2010), while only gram-negative bacteria were susceptible to the extract of S. malaccense (Bouzada et al. 2009). Although multiple studies have analyzed chemical compounds and the antibacterial activities of extracts from different Myrtaceae family plants (Al-Abd et al. 2015; Salem et al. 2017; Isah et al. 2023), few studies have evaluated the potential of these extracts in in vivo testing to control the incidence of fungal plant diseases.

Therefore, the objective of our research was to investigate the possibility of employing ethanolic extracts from Myrtaceae plants as an alternative approach for managing Alternaria leaf spot in lettuce. For this purpose, an experimental series was carried out to determine the following: (1) the phytotoxicity of Myrtaceae plant extracts on the cultivated crop, (2) the direct effects of Myrtaceae extracts on mycelial growth and spore germination of a fungal pathogen of lettuce leaf spot, (3) the phytochemical profile of Myrtaceae plant extracts according to liquid chromatography (LC) / mass spectrometry (MS) and gas chromatography (GC) / MS, (4) the potential of Myrtaceae plant extracts as an inducer for defense-related enzymes for controlling Alternaria leaf spot in lettuce grown in hydroponics and (5) the correlation between disease severity and defense enzymes.

Materials and Methods

Myrtaceae extracts preparation

Four Myrtaceae plants were studied here. Callistemon viminalis (CV), Syzygium jambos (SJ),and Syzygium malaccense (SM) were collected from an area in Bangkok province, while Melaleuca cajuputi (MC) was collected from Chumphon province in Thailand.

Crude extracts using 95% ethanol

Fresh leaves of the Myrtaceae plants were cleaned with tap water and dried in open air. The leaf samples were then completely dried using a hot air oven (Memmert) at 50°C. The dried leaves were ground and extracted using the Soxhlet extraction technique with 95% ethanol, after which the ethanol solvent was evaporated with a rotary evaporator (Buchi, Rotavapor R300) at 50°C. The sticky extracts were kept at 4°C for further study.

Crude extracts using 50% ethanol

The method used to extract the Callistemon viminalis leaves was identical to that used with the 95% ethanolic crude extracts but with 50% ethanol instead as a solvent.This extract as well was kept at 4°C for further study.

Identification of Alternaria species by sequence analysis

The Alternaria isolate in this experiment obtained from our previous research (Somnuek et al. 2020) was morphologically identified and already proven with regard to its pathogenicity. Here, the identification of Alternaria species was confirmed by molecular identification. The genomic DNA of the tested fungus was extracted and the extracted DNA was used as the template for amplification with the ITS1 primer (5’ TCCGTAGGTGAACCTGCGG 3’) and ITS4 primer (5’ TCCTCCGCTTATTGATATGC ’3) of the internal transcribed spacer (ITS) of rDNA regions via polymerase chain reaction (PCR), with the process conducted according to the work of Mohammadi and Bahramikia (2019). The purified PCR products were sequenced by Bionics Co., Ltd. of Korea. Sequence similarity analyses were conducted using the Basic Local Alignment Search Tool (BLAST) in the GenBank NCBI database.

Preliminary phytochemical screening of leaf extracts from four Myrtaceae plants

Phytochemical compounds such as phenols, flavonoids, tannins, alkaloids, and terpenoids showed antifungal properties on plant pathogenic fungi, and they acted in a synergistic manner (Tiwari et al. 2011; Gurjar et al. 2012). Therefore, this part of the experiment was undertaken to screen the targeted phytochemical compounds from the ethanolic crude extracts of Callistemon viminalis (95% EECV), Melaleuca cajuputi (95% EEMC), Syzygium jambos (95% EESJ),and Syzygium malaccense (95% EESM). Phytocompounds were detected according to a slightly modified version of the methods of Harborne (1998), Iqbal et al. (2015) and Dubale et al. (2023). The qualitative results were assessed by means of colorimetric reactions and were presented here as positive (+) for the presence of and negative (–) for the absence of phytochemicals.

Phytotoxicity of four Myrtaceae extracts on lettuce grown in hydroponics

Plant extracts, an important source of bioactive compounds, have been suggested as a viable, environmentally friendly option for plant disease control. However, plant extracts may also have negative impacts on cultivated crops. Therefore, a preliminary test was conducted here to find the extract with the least negative effect on lettuce grown in a hydroponic system. The experiment utilized a 4 × 4 × 2 factorial in a completely randomized design (CRD) with 3 replications (3 plants per replicate). Factor A was the type of plant extract (EECV, EEMC, EESM, and EEMJ), Factor B was the concentration of the extract used (0, 5,000, 25,000 and 50,000 ppm), and Factor C was the number of applications (one time and two times). The tested lettuce plants were grown in a deep water culture (DWC) system, which was constructed from a plastic box (25 × 34 × 15 cm) and filled with a nutrient solution (EC = 1.6–1.8 mS/cm, pH = 5.8–6.2) (Benoit and Ceustermans 1995). Subsequently, 2 ml of each prepared extract was sprayed on 15-day-old lettuce seedlings, and this step was repeatedly sprayed on 30-day-old lettuce seedling group. Phytotoxicity was evaluated according to the incidence of necrosis and discoloration at 1 to 3 days after the foliar spray. Moreover, the lettuce growth parameter of leaf greenness of the lettuce under test was monitored weekly using a chlorophyll meter (SPAD-502, Konica Minolta Sensing, Inc., Japan) after foliar spraying, whereas the fresh weights of the plants were recorded at the end of the cultivation period.

In vitro antifungal activity of Myrtaceae extracts on the growth of Alternaria sp.

Effect of four Myrtaceae extracts on mycelial growth

The effect of the ethanolic extracts from the four Myrtaceae plants on the mycelium growth of Alternariabrassicicola was investigated using 4 × 4 factorials in a completely randomized design (CRD). Factor A indicated the 4 Myrtaceae plants, and Factor B represented the 4 concentrations of the extracts used. The crude extracts were tested with regard to the mycelial growth of A. brassicicola by a poisoned food technique. A fungus was cultured on potato dextrose agar (PDA; Sisco Research Laboratories Pvt. Ltd., India) at room temperature (~25°C). Mycelial disks, 0.5 cm in diameter, were cut from the margins of the colonies and inoculated onto PDA mixed with each extract. The sizes of A. brassicicola colonies in the control plate and the plate containing the extract were determined at 3, 5, and 7 days after inoculation. Mycelial growth inhibition was calculated using the following formula: Mycelial growth inhibition (%) = (DC–DT)/DC × 100

where DC = diameter of the Alternaria colony on the control plate

DT = diameter of the Alternaria colony on the plate containing the extract

Effect of potentially selected Myrtaceae extracts on spore germination

Two plant extracts (95% EEMC and 95% EECV) showing high-potential antifungal activity in the mycelium growth test described above were selected and tested further for their effect on A. brassicicola spore germination. The experiment was carried out by CRD. One mL of spore suspension (approximately 105 spores/mL) was inoculated into 1 mL of PDB in test tubes with 5 extract concentrations (1,000, 5,000, 10,000, 15,000 and 50,000 ppm). Sterilized water and mancozeb (500 ppm) were used as inoculated and chemical controls, respectively. Then, spore germination of the tested fungus was observed under a light microscope at 24, 48, and 72 h.

GC/MS and LC/MC-TOF analyses of the Myrtaceae extracts

GC/MS and LC/MS have often been used to analyze phytochemical compounds in plant extracts. The two methods are more alike than different. The only key difference between the systems is that GC/MS uses a gas mobile phase while LC/MS uses a liquid mobile phase. Therefore, GC/MS appears to be more applicable to more volatile and gas samples.

GC/MS analyses of the 95% EEMC and 95% EECV were carried out according to a slightly modified method based on Al-Abd et al. (2015) and Hassan et al. (2022). A gas chromatograph-mass spectrometer (7890 B GC–5977A MSD, Agilent Technologies, Inc., USA) was employed for these analyses. A HP-5 Ultra Inert column (30 m × 250 µm × 0.25 µm, Agilent Technologies) with helium (He, flow rate = 40 cm/s) as the carrier gas was used. The oven was initially programmed to run at a temperature of 60°C (hold time 2 min), a rate of 7°C/min to 150°C (hold time 1 min), a rate of 2°C/min to 230°C (hold time 1 min), and a rate of 15°C/min to 300°C (hold time 15 min). The injection volume of 1 µL operated in the split mode with a ratio of 10:1. The MS transfer line and ion source temperatures were maintained at 230°C and 150°C, respectively, and the mass spectra detector voltage was set at 70 eV. The scan range was from 35 to 600 m/z. Peaks and chemical constituents were identified by a MassHunter Workstation Software Quantitative Analysis Version B.09.00 Unknown Analysis.

The LC/MS analyses of the 95% EEMC and 95% EECV were conducted according to a slightly modified method based on Al-Abd et al. (2015). The system for analyzing the samples consisted of a high-performance liquid chromatograph- mass spectrometer-quadrupole time-of-flight [ExonLCTM AD Series (LC) and X500R QTOF system (QTOF),-SCIEX] with dual electrospray ionization (ESI). The LC separation steps were performed using a 2.1 mm (i.d.) narrow-bore SB-C18 (length 150 mm, particle size 3.5 mM) analytical column. The LC parameters used were: 25°C for the autosampler temperature, 1 µL for the injection volume, 25°C for the column temperature, and 0.4 mL/min for the flow rate. A gradient system consisting of 0.1% formic acid in water as solvent A and 0.1% formic acid in acetonitrile as solvent B was used. The mass spectra data were acquired using an ESI capillary voltage of (+) 4000 V in the positive ion mode with the fragmentor set to 125 V. Other conditions were set to 45 psi for the liquid nebulizer, a flow rate of 10 L/min with the drying gas, and vaporizer temperatures maintained at 300°C for the nitrogen drying gas. Moreover, the ionization interface was operated in positive mode. The data were collected and analyzed using SCIEX OS 2.1.0.

Evaluation of EEMC and EECV as an inducer on development of Alternaria leaf spot and the induction of defense enzymes in lettuce grown in a hydroponic system

In addition to a direct effect evaluation, we also focused on an indirect effect of the extracts as inducers on Alternaria leaf spot disease severity as well as on the activity of defense enzymes. Two experiments were separately conducted, one to assess the effect of 95% EEMC (15,000 and 50,000 ppm) and the other to test 95% EECV (15,000 and 50,000 ppm). Moreover, 50% EECV, given its potential to stimulate lettuce growth as determined in our previous research (Somnuek et al. 2020), was also included in the 95% EECV experiment for further evaluation as an inducer on defense enzyme activity.

The EEMC effect

Preparation and experimental design

In order to make certain of the indirect effect of EEMC as an inducer, a hydroponic experiment with lettuce was carried out. First, lettuce seeds were germinated in a plastic tray on a moist sponge with nutrient solution (EC = 1, pH = 5.8–6.2) for 14 days. The seedlings were then transferred to grow in DWC with nutrient solution (EC = 1.6–1.8 mS/cm, pH= 5.8–6.2). The 95% EEMC at 15,000 and 50,000 ppm were prepared and foliar sprayed on the above lettuce seedlings (1 mL/plant). The treated seedlings were inoculated with a 100 µL of testedspore suspension (approximately 106 spores/mL) a day after spraying with the plant extract. CRD with 3 replications (3 plants per replicate) was used in this experiment, as follows:

T1 = Healthy control, T2 = Inoculated control, T3 = Chemical control (mancozeb 500 ppm)

T4 = 95% EEMC (15,000 ppm), T5 = 95% EEMC (50,000 ppm)

Determination of disease severity

The treated leaves were observed at 1, 3, 5 and 7 days after inoculation (DAI), and a disease index was scored using a scale of 0 to 4 for the lesion size: 0 = no infection, 1 = 1 to 5 mm, 2 = 5 to 10 mm, 3 = 10 to 15 mm, and 4 ≥ 15 mm. Disease severity (DS) of the tested lettuce leaves was analyzed using the following equations:

% DS = [∑ (number of infected leaves × disease index) / number of total leaves × the highest disease index] × 100.

In addition, the plant growth parameters, such as the greenness value (by chlorophyll meter; SPAD-502, Konica Minolta Sensing, Inc., Japan) and fresh weight were checked at 1, 3, 5, 7 days after spraying and at harvest.

Induction of plant defense enzymes due to the effect of the inducer

During pathogenesis, plant defense enzymes were also determined. The aforementioned treated lettuce leaves were collected at 1, 3, 5, and 7 days after foliar spraying. Three treated leaves were sampled from each replication of the treatment and were ground using liquid nitrogen. Then, 1 g of the tested leaf sample in each case was homogenized with 2 mL of 0.1 M sodium phosphate buffer (pH 7.0). The homogenate was centrifuged for 20 min at 10,000 rpm in a cooling centrifuge at 4°C. Subsequently, peroxidase, chitinase, and β-1,3-glucanase were detected according to a modified version of the method introduced by Verburg and Huynh (1991), Boller and Mauch (1988), Gupta et al. (2013) and Selvaraj and Ambalavanan (2013).

β-1,3-glucanase activity

The homogenate of 62.5 µL was mixed with laminarin (4% w/v in 0.05 M sodium acetate buffer, pH 5.0) of 62.5 µL for 10 min at 40°C. The reaction was then stopped by adding 375 µL of DNS and heating this solution for 5 min in a boiling water bath. The absorbance was detected by a spectrophotometer at 500 nm. The enzyme activity was expressed as µmol glucose/g of fresh leaves.

Chitinase activity

The homogenate of 0.4 ml was mixed with colloidal chitin (0.1% w/v in 0.05 M sodium acetate buffer, pH 5.0) at a ratio of 1:1 and incubated at 37°C for 2 hrs with the product of N-acetyl glucosamine (GlcNAc). Then, the chitinase activity was detected with a spectrophotometer at 585 nm. The enzyme activity was expressed as µmol GlcNAc/g of fresh leaves.

Peroxidase (PO) activity

The enzyme supernatant of 100 µl was taken along with 0.05 M pyrogallol. To initiate the enzyme reaction, 1% H2O2 in an amount of 0.5 ml was added. The change in the absorbance was recorded by a spectrophotometer at 420 nm at 30 sec intervals for 3 min from zero seconds of incubation at room temperature. The result was expressed as the change in unit/g of fresh leaves.

The EECV effect

In this experiment, the preparation and experimental design, including the determination of disease severity and the plant defense enzyme activity, were carried out in the same manner as in the 95% EEMC experiment. Treatments in the experiment were as follows:

T1 = Healthy control, T2 = Inoculated control, T3 = Chemical control (mancozeb 500 ppm)

T4 = 50% EECV (15,000 ppm), T5 = 50% EECV (50,000 ppm), T6 = 95% EECV (15,000 ppm),

T7 = 95% EECV (50,000 ppm)

Correlation of disease severity and plant defense enzymes

In order to understand the relationship between the severity of leaf spot disease and the induced plant defense enzymes, as well as to confirm that these defense enzymes have a role in leaf spot management in lettuce, the correlation coefficients (r) between disease severity and the defense enzymes of β-1,3-glucanase, chitinase and peroxidase were estimated by standard statistical calculations. Simple regression equations (Y= a + bx) were also developed for all variables.

Results and Discussion

Identification of Alternaria species by sequence analysis

Alternaria species (Somnuek et al. 2020) was confirmed by ITS identification. The nucleotide sequences in the tested isolate were approximately 568 bp in size. The nucleotide sequence of the tested Alternaria isolate Alt-LL1 (OR226735) allowed an identification of Alternariabrassicicola. Our findings were in agreement with those of many researchers who reported that A. brassicicola was the causal agent of leaf spot disease in a number of vegetable crops, including lettuce (Pattanamahakul and Strange 1999; Dethoup et al. 2018; O’Neill 2019; Blagojević et al. 2020).

Phytochemical screening of four Myrtaceae leaf extracts

Our study confirmed the presence of qualitative phytochemical compounds, specifically phenol, flavonoids, and tannins, in all tested extracts (Table 1). High levels of phenols and flavonoids were especially detected in the 95% EEMC. Terpenoids were found only in the 95% EEMC and 95% EECV while alkaloids were not found in any of the extracts. Our findings were in accordance with those of many researchers who reported that the targeted phytochemical compounds, i.e., phenol, flavonoids, tannins, alkaloids and terpenoids, were found in several Myrtaceae plants, such as the fruit extract of M. cajuputi (Isnaini et al. 2023), C. viminalis extract (Salem et al. 2017), an extract from the leaves and bark of S. jambos (Wamba et al. 2018), the leaf extract of S. malaccense (Patel et al. 2019) and an extract from Psidium cattleianum leaves(Faleiro et al. 2016). These targeted phytocompounds were detected in other plant extracts as well (Tiwari et al. 2011; Gurjar et al. 2012).

Table 1.

Phytochemical compounds of 95% ethanolic crude extracts from the leaves of 4 Myrtaceae plants

Phytochemical compound Plant extract
EEMC EECV EESJ EESM
Phenols ++z + + +
Flavonoids ++ + + +
Tannins + + + +
Alkaloids – – – –
Terpenoids + + – –

z++ = high presence, + = moderate presence, – = absence.

Phytotoxicity of four Myrtaceae extracts on lettuce grown in hydroponics

The phytotoxic effect of the four Myrtaceae extracts on lettuce was assessed by the foliar spray technique. Of the 4 Myrtaceae extracts evaluated here, none of the treatments showed phytotoxicity (such as browning and discoloration) on lettuce at 15 and 30 days (Table 2). Regarding the plant growth parameters, the SPAD values did not differ significantly (p < 0.05) from control and the other treatments, while the fresh weights were dependent on the plant extracts and corresponding concentrations but not on the application times. The 95% EECV at all concentrations significantly (p < 0.05) stimulated the fresh weight of lettuce (65.5–70.2 g/plant) compared to those treated with other plant extracts (39–43.5 g/plant). In addition, an increase in the extract concentration appeared to stimulate lettuce growth more strongly (Table 2 and Fig. 1). This result also agreed with our previous research (Somnuek et al. 2020), which reported that 3 ethanolic extracts from C. viminalis (50%, 70% and 95% EECV) at 5,000–50,000 ppm showed no phytotoxic effect and still increased seed germination and the growth of lettuce. More notably, the water extract of this plant showing no phytotoxicity could still promote the growth of rice (Bali et al. 2017). Apart from the 95% EECV, the research on the phytotoxic effect of the other 3 tested plant extracts was rather limited, most likely due to the fact that these plants were Thai native plants. Furthermore, no phytotoxicity of extracts from other plants within Myrtaceae, such as Myrcia tomentosa (Imatomi et al. 2013), Myrciaria dubia (Kunth) McVaugh (Rita et al. 2017), Eucalyptus globulus (Puig et al. 2018), clove, tea tree, jaboticaba and guava (Carmello and Cardoso 2018; Teixeira et al. 2018), was also noted together with the stimulating effects on growth parameters (e.g., germination percentage, germination speed index, leaf number, root length, and yield) in lettuce. In contrast, phytotoxic effects of Myrcia vittoriana (Myrtaceae) in a plant model (lettuce and onion) have recently been reported by Vasconcelos et al. (2022). Because the 4 Myrtaceae plant extracts have been proven so far from this experiment to have no negative effects on lettuce, their antifungal activities against Alternaria sp. in vitro and against leaf spot of lettuce grown in a hydroponic system should be investigated further.

Table 2.

Phytotoxicity test of 95% ethanolic crude extracts from 4 Myrtaceae plants on lettuce grown in a hydroponic system

Factor A
(Plant extract)
Factor B
(Concentration)
Factor C
(Application time)z
Phytotoxicityy
(3 DAT)
SPAD value Fresh weight
(g/plant)
EECV 0 ppm One time – 31.6 ax 40.9 c
Two times – 30.2 a 42.5 c
5,000 ppm One time – 31.4 a 65.5 b
Two times – 31.5 a 67.3 ab
25,000 ppm One time – 30.8 a 68.9 ab
Two times – 32.4 a 67.4 ab
50,000 ppm One time – 32.5 a 68.3 ab
Two times – 30.7 a 70.2 a
EEMC 0 ppm One time – 33.4 a 40.9 c
Two times – 32.2 a 42.5 c
5,000 ppm One time – 33.2 a 39.0 c
Two times – 31.6 a 43.5 c
25,000 ppm One time – 30.6 a 40.1 c
Two times – 32.2 a 41.1 c
50,000 ppm One time – 31.3 a 40.6 c
Two times – 31.9 a 40.1 c
EESJ 0 ppm One time – 32.0 a 40.9 c
Two times – 30.6 a 42.5 c
5,000 ppm One time – 33.8 a 40.4 c
Two times – 33.2 a 39.6 c
25,000 ppm One time – 32.0 a 41.1 c
Two times – 32.0 a 39.4 c
50,000 ppm One time – 32.0 a 40.2 c
Two times – 30.8 a 41.2 c
EESM 0 ppm One time – 32.0 a 40.9 c
Two times – 32.8 a 42.5 c
5,000 ppm One time – 32.0 a 39.0 c
Two times – 30.5 a 39.2 c
25,000 ppm One time – 32.0 a 40.2 c
Two times – 30.2 a 40.0 c
50,000 ppm One time – 32.3 a 40.6 c
Two times – 32.5 a 40.4 c
C.V. (%) 4.56 7.59
A ns ÚÚ
B ns ÚÚ
C ns ns
A × B ns ÚÚ
A × C ns ns
B × C ns ns
A × B × C ns ns

zApplication time: For one time group, the spray was made at 15 days. For two times group, sprays were made at 15 and 30 days.

y– showing non-phytotoxicity, + showing phytotoxicity.

xValues are the means of 3 replicates. Values in each column followed by the same letter are not significantly different according to LSD (p > 0.05).

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-01/N0130430102/images/HST_43_01_02_F1.jpg
Fig. 1.

A photo (at harvest) showing the non-phytotoxicity and plant growth stimulating effect of the 95% ethanolic extract of C. viminalis (95% EECV) spraying onto lettuce in a hydroponic system. Bar = 20 cm.

In vitro antifungal activity of Myrtaceae extracts against growth of Alternaria sp.

Effect of four Myrtaceae extracts on mycelial growth

The antifungal activities of crude ethanolic extracts from the four Myrtaceae plants, i.e., Callistemon viminalis (95% EECV), Melaleuca cajuputi (95% EEMC), Syzygium jambos (95% EESJ) and Syzygium malaccense (95% EESM) at different concentrations were significantly (p < 0.05) noted against A. brassicicola mycelial growth. Moreover, their effect was dependent on the concentration of the extract and on the Myrtaceae plant species (Fig. 2). The 95% EEMC at all tested concentrations (5,000, 15,000 and 50,000 ppm) statistically (p < 0.05) showed the highest inhibitory effect (85–100%), while 95% EECV was the next most effective extract, with activity in the range of 40–63%. The 95% EESM and 95% EESJ presented inhibitory effects in the corresponding ranges of 15–80% and 30–40% (Fig. 2). The antifungal activity found in this experiment is attributable to the presence of phytochemical compounds such as phenolics, flavonoids, tannins and terpenoids. These phytocompounds were reported to have good antifungal effects on plant pathogens (Al-Abd et al. 2015; Bharat and Praveen 2016; Salem et al. 2017; Patel et al. 2019). The mode of action of the phytochemicals includes membrane disruption, enzyme inactivation, protein binding and toxicity (Tiwari et al. 2011; Gurjar et al. 2012). Moreover, the significant in vitro antifungal activities of 4 extracts were in good agreement with the aforementioned phytochemical screening test, which showed the highest phytochemical substance levels in the 95% EEMC and 95% EECV. This study was in line with those of other researchers who found that M. cajuputi (essential oil) had strong inhibitory effects on Alternaria spp. (Pawar and Thaker 2007; Siddique et al. 2018), Aspergillus spp. (Thanaboripat et al. 2007; Thanaboripat 2011; Bharat and Praveen 2016; Thanaboripat et al. 2016; Siddique et al. 2018), Fusarium spp. (Pawar and Thaker 2007; Siddique et al. 2018) and Penicillium digitatum (Siddique et al. 2018). Apart from having antifungal activity, the methanolic extract of M. cajuputi also exhibited antimicrobial activity against certain bacteria, such as Bacillus spp., Enterococcus faecalis (Ukit et al. 2019), S. aureus, Vibrio cholerae, Shigella dysenteriae, and Staphylococcus epidermidis (Al-Abd et al. 2015; Ukit et al. 2019). Of the 4 extracts tested here, the 95% EECV result confirmed the inhibitory effect, as noted in our previous research (Somnuek et al. 2020), against Alternaria sp. For 95% EESJ, our result agreed with other studies testing seed and leaf extracts. The seed extract was effective at controlling certain fungi, e.g., Candida albicans, Microsporum canis, and M. gypseum (Sakander et al. 2015), while the leaf extract inhibited the bacteria, namely Salmonella typhi (Murugan et al. 2011), Aeromonas hydrophila, Alcaligenes faecalis, Bacillus cereus and Staphylococcus aureus (Mohanty and Cock 2010). In the 95% EESM case, S. malaccense leaf extracts showed inhibition activity against Pseudomonas aeruginosa, Salmonella typhi, and Shigella sonnei (Bouzada et al. 2009).

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-01/N0130430102/images/HST_43_01_02_F2.jpg
Fig. 2.

Mycelial growth inhibition of A. brassicicola by different concentrations of 95% ethanolic extract of 4 Myrtaceae plants (EECV = Callistemon viminalis; EEMC = Melaleuca cajuputi, EESJ = Syzygium jambos; EESM = Syzygium malaccense) (A) and corresponding growth outcomes on Petri dishes (B).

Effect of potentially selected Myrtaceae extracts on spore germination

Potentially selected Myrtaceae extracts tested here, i.e., 95% EEMC and 95% EECV, at different concentrations (1,000, 5,000, 10,000, 15,000 and 50,000 ppm) were further evaluated for their antifungal activities on spore germination of A. brassicicola. Both 95% EEMC and 95% EECV at all tested concentrations indicated a significant (p < 0.05) inhibitory effect on spore germination (Fig. 3). Complete inhibition was noted upon the application of 95% EEMC at 5,000–50,000 ppm (Fig. 3), while abnormal spores were detected at all tested concentrations. At 72 hrs, abnormalities of A. brassicicola spores were detected, taking the forms of collapsed spores, degraded cell walls, and ungerminated spores (Fig. 3). For 95% EECV, complete inhibition of spore germination was initially noted at 10,000 ppm and up. However, abnormal spores were only found at the highest extract concentration (50,000 ppm). Overall, we found that the higher concentration of plant extract induced the more potent inhibition of the growth of the pathogen in terms of mycelial growth and spore germination. Subsequently, the corresponding phytochemical profile responsible for this potent activity was further clarified in the following experiment, as described below.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-01/N0130430102/images/HST_43_01_02_F3.jpg
Fig. 3.

Bar graph showing the inhibition effects of different concentrations of 95% ethanolic crude extracts from M. cajuputi (95% EEMC) and C. viminalis (95% EECV) on spore germination of A. brassicicola.

Phytochemical profile of the Myrtaceae extracts by GC/MS and LC/MC-TOF

The 95% EEMC and 95% EECV were selected from the four Myrtaceae extracts due to their potential plant-growth stimulating effect and antifungal activities from the experiment described above. Subsequently, both 95% EEMC and 95% EECV were analyzed for non-targeted phytochemical compounds by GC/MS QTOF and LC/MS QTOF techniques. An overview of all annotated compounds of 95% EEMC and 95% EECV was given in Tables 3 and 4. These compounds were summarized along with their retention time, molecular formula, m/z, peak area and known bioactivity from the literature.

Table 3.

Phytochemical compounds from the 95% ethanolic extract of Thai M. cajuputi (95% EEMC) analyzed by GC/MS QTOF and LC/MS QTOF

Compound name RT
(min)
Molecular
formula
m/z Peak area
(%)
Known bioactivity from literature
By GC/MS QTOF
Terpenoids
1 Copaene 16.74 C15H24 204 0.20 antimicrobial (Scur et al. 2016)
2 β-Elemene 17.12 C15H24 204 0.64 anticancer (Xie et al. 2020)
3 Caryophyllene 17.87 C15H24 204 0.41 antimicrobial (Selestino Neta et al. 2017)
4 α-Muurolene 19.35 C15H24 204 0.33 antimicrobial (Marinas et al. 2021)
5 β-Selinene 19.59 C15H24 204 0.95 antifungal (Ding et al. 2017)
6 γ-Selinene 19.82 C15H24 204 0.39 antifungal (Foudah et al. 2021)
7 Elemol 21.26 C15H26O 222 0.35 antimicrobial (Noriega et al. 2020)
8 Spathulenol 22.22 C15H24O 220 0.45 antimicrobial (Fu et al. 2022)
9 Caryophyllene epoxide 22.44 C15H24O 220 2.53 antimicrobial (Selestino Neta et al. 2017)
10 Muurola-4,10(14)-dien-1β-ol 23.78 C15H24O 220 1.54 unknown
11 Caryophylla-4(12),8(13)-dien-5α-ol 24.00 C15H24O 220 1.71 antimicrobial (Selestino Neta et al. 2017)
12 10,10-Dimethyl-2,6-dimethylenebicyclo[7.2.0]undecan-5β-ol 24.12 C15H24O 220 3.89 unknown
13 β-Eudesmol 24.39 C15H26O 222 0.27 antimicrobial (Noriega et al. 2020)
14 Selin-6-en-4α-ol 24.61 C15H26O 222 2.12 antibacterial (Cordeiro et al. 2020)
15 Aromadendrene epoxide 24.75 C15H24O 220 2.45 antimicrobial (Mulyaningsih et al. 2011)
16 8-Methoxycedrane 25.27 C17H28O2 264 0.74 unknown
17 (1R,7S,E)-7-Isopropyl-4,10-dimethylenecyclodec-5-enol 25.44 C15H24O 220 1.17 unknown
18 Pluchidiol 26.97 C13H20O2 208 0.21 antimicrobial (Karimi et al. 2019)
19 Proximadiol 29.55 C15H28O2 222 0.25 unknown
20 α-Eudesmol 30.29 C15H26O 222 1.40 antimicrobial (Noriega et al. 2020)
21 Squamulosone 30.90 C15H22O 218 0.78 unknown
22 6,10,14-Trimethyl-2-pentadecanone 31.46 C18H36O 268 0.43 antibacterial (Naidoo et al. 2014)
23 Corymbolone 31.55 C15H24O2 236 0.40 antifungal (Hussein et al. 2016)
24 4,4,8-Trimethyltricyclo[6.3.1.0(1,5)]dodecane-2,9-diol 31.67 C15H26O2 238 0.54 unknown
25 Estra-1,3,5(10)-trien-17β-ol 32.82 C18H24O 256 0.91 anticancer (Khan et al. 2022)
26 Phytol 38.60 C20H40O 296 19.14 antimicrobial (Saha and Bandyopadhyay 2020;
Yusoff et al. 2020; Petpheng et al. 2023)
27 γ-Sitosterol 41.19 C29H50O 414 0.54 antibacterial (Subramaniam et al. 2014)
28 28-Norolean-17-en-3-ol 42.70 C29H48O 412 0.57 antiviral (Darshani et al. 2022)
Terpenoids 45.31
Phenolics
29 Ethyl α-d-glucopyranoside 23.67 C8H16O6 208 1.66 antioxidant (Dai et al. 2022)
30 2-Hydroxy-5-methoxybenzaldehyde,TMS derivative 25.82 C11H16O3Si 224 0.26 antibacterial (Durgadevi et al. 2019)
Phenolics 1.92
Flavonoids
31 Pinostrobin 32.53 C11H10O4 206 0.32 antibacterial (Marliyana et al. 2018)
Flavonoids 0.32
Naphthalenes & Aromatics
32 1,2,3,4-Tetrahydronaphthalene-1,2-diol,5,6-dimethoxy- 23.15 C12H16O4 164 8.45 unknown
33 9-Butyl-9H-fluoren-9-ol 36.55 C17H18O 238 0.40 unknown
Naphthalenes & Aromatics 8.85
Other compounds
34 2,5-Dimethoxythiophenol 15.71 C8H10O2S 170 0.26 unknown
35 Butyric acid, 2,3-epoxy-, ethyl ester 21.47 C11H16O 164 0.23 unknown
36 2',3',4' Trimethoxyacetophenone 26.46 C11H14O4 210 7.16 antibacterial (Freitas et al. 2020)
37 2,5,5,8a-Tetramethyl-4-methylene-6,7,8,8a-tetrahydro-4H,5H-
chromen-4a-yl hydroperoxide
28.99 C14H22O3 238 1.23 unknown
38 Octahydro-1-(2-octyldecyl)- pentalene 30.51 C26H50 362 3.63 unknown
39 10-Methylanthracene-9-carboxaldehyde 33.23 C16H12O 220 11.63 unknown
40 2-Isopropyl-10-methylphenanthrene 37.35 C18H18 234 5.32 unknown
41 5-Methyl-6,7,8,9-tetrahydroisothiazolo[5,4-C]isoquinolin-1(2H)-one 37.79 C11H12N2OS 220 12.53 unknown
Other compounds 41.99
Total 98.39
By LC/MS QTOF
Terpenoids
1 Ingenol 15.36 C20H28O5 348 9.17 anti-HIV (Fujiwara et al. 1996)
Terpenoids 9.17
Phenolics
2 Acetaminophen 11.99 C8H9NO2 151 9.93 antifungal (Srikanth et al. 2005)
3 6-Gingerol 12.51 C17H26O4 294 2.75 antifungal (Xi et al. 2022)
4 3,5-Di-tert-butyl-2-hydroxybenzaldehyde 27.74 C15H22O2 234 6.81 antimicrobial (Zhao et al. 2020)
Phenolics 19.49
Flavonoids & Naphthalene
5 Cyanidin-3-O-sophoroside 0.58 C27H31O16+ 611 1.34 antibacterial (Tan et al. 2019)
6 6,2'-Dimethylflavone 15.72 C17H14O4 282 4.21 antifungal (Mangoyi et al. 2015)
Flavonoids & Naphthalene 5.55
Steroids & Benzofurans
7 5β-Androstane-3β,17β-diol 12.54 C19H32O2 292 3.84 unknown
8 Dichlorofluorescein 14.80 C20H10Cl2O5 401 3.95 unknown
Steroids & Benzofurans 7.79
Ethylene glycol
9 Nonaethylene glycol 0.58 C18H38O10 415 10.28 antimicrobial (Shukla et al. 2012)
10 Decaethylene glycol 0.58 C20H42O11 459 10.42 antimicrobial (Shukla et al. 2012)
11 Pentaethylene glycol 12.51 C10H22O6 238 5.55 antimicrobial (Shukla et al. 2012)
Ethylene glycol 26.25
Vitamins
12 R-lipoic acid 0.46 C8H14O2S2 207 6.63 PGPMz (Elkelish et al. 2021)
Vitamins 6.63
Fatty acid & Glucosides
13 2,3-Dinor-11β-prostaglandin F2α 12.56 C18H30O5 326 9.45 unknown
14 Harpagide 14.4 C15H24O10 364 3.46 unknown
Fatty acid & Glucosides 12.91
Other compounds
15 1-(1',3'-Benzodioxol-5'-yl)-2-butanamine 0.42 C11H15NO2 193 1.03 unknown
16 Salicylic acid, valerate 0.82 C12H14O4 222 3.70 ISRy (War et al. 2011; Sangpueak et al. 2021)
17 2-Acetyl-5-(tetrahydroxybutyl)imidazole 12.47 C9H14N2O5 230 1.24 unknown
18 Leukotriene B3 12.54 C20H34O4 338 3.34 antibacterial (Serban et al. 2018)
Other compounds 9.31
Total 97.1

zPGPM = Plant growth promoting metabolites.

yISR = Induced systemic resistance.

Table 4.

Phytochemical compounds from the 95% ethanolic extract of Thai C. viminalis (95% EECV) analyzed by GC/MS QTOF and LC/MS QTOF

Compound name RT
(min)
Molecular
formula
m/z Peak area
(%)
Known bioactivity from literature
By GC/MS QTOF
Terpenoids
1 α-Phellandrene 8.96 C10H16 136 2.04 antimicrobial (İşcan et al. 2012)
2 o-Cymene 9.39 C10H14 134 0.84 antimicrobial (Tadtong et al. 2016)
3 1,8-Cineole 9.52 C10H18O 154 14.0 antimicrobial (Tadtong et al. 2016;
Şimşek and Duman 2017; Kim et al. 2018)
4 α-Terpinene 10.77 C10H16 136 0.19 antifungal (Marei and Abdelgaleil 2018)
5 Terpinen-4-ol 12.64 C10H18O 154 0.36 antifungal (Marei and Abdelgaleil 2018;
Kamiya et al. 2024)
6 L-α-Terpineol 12.89 C10H18O 154 1.42 antifungal (Marei and Abdelgaleil 2018)
7 2-Acetoxy-1,8-cineole 15.24 C12H20O3 212 0.26 antimicrobial (Tadtong et al. 2016)
8 Caryophyllene 17.86 C15H24 204 0.35 antimicrobial (Selestino Neta et al. 2017)
9 γ-Selinene 19.81 C15H24 204 0.20 antifungal (Foudah et al. 2021)
10 Spathulenol 22.21 C15H24O 220 0.76 antimicrobial (Fu et al. 2022)
11 Isoleptospermone 23.65 C15H22O4 266 1.01 unknown
12 Pluchidiol 29.46 C13H20O2 208 0.57 unknown
13 α-Phellandrene, dimer 29.82 C20H32 272 0.76 antimicrobial (İşcan et al. 2012)
14 Phytyl acetate 31.42 C22H42O2 338 0.49 antifungal (Foudah et al. 2021)
15 4,4,8-Trimethyltricyclo[6.3.1.0(1,5)]dodecane-2,9-diol 32.82 C15H26O2 238 0.33 unknown
16 Phytol 42.67 C20H40O 296 0.53 antimicrobial (Saha and Bandyopadhyay 2020;
Yusoff et al. 2020; Petpheng et al. 2023)
17 Vitamin E 65.48 C29H50O2 430 0.56 PGPMz (Muñoz and Munné-Bosch 2019)
18 γ-Sitosterol 68.15 C29H50O 414 1.91 antibacterial (Subramaniam et al. 2014)
19 Lanosterol 68.76 C30H50O 426 0.52 unknown
20 28-Norolean-17-en-3-ol 69.25 C29H48O 412 1.02 antibacterial (Kim et al. 2015)
21 α-Amyrin 69.56 C30H50O 426 0.40 antibacterial (Chung et al. 2011)
22 γ-Sitostenone 70.52 C29H48O 412 0.64 antibacterial (Subramaniam et al. 2014)
23 Betulinaldehyde 73.64 C30H48O2 440 0.88 antibacterial (Chung et al. 2011)
Terpenoids 30.04
Phenolics
24 2'-Hydroxy-5'-methoxyacetophenone, 3-methylbutylether 20.33 C14H20O3 236 1.70 unknown
25 2,6-Di-tert-butyl-4-hydroxy-4-methylcyclohexa-2,5-dien-1-one 23.24 C15H24O2 236 1.77 unknown
Phenolics 3.47
Flavonoids
26 Hesperetine 58.40 C17H14O7 330 0.39 antimicrobial (Carevic et al. 2022)
27 Prosogerin E 60.00 C18H16O7 332 2.06 antibacterial (Shamsudin et al. 2022)
28 Guaiacin 60.63 C20H24O4 328 0.32 unknown
29 8-hydroxysalvigenin 64.71 C18H16O5 312 0.71 antimicrobial (Alreshidi et al. 2020)
30 4',7-Di-O-methylnaringenin 65.01 C19H18O5 326 1.79 antibacterial (Kozłowska et al. 2017)
Flavonoids 5.27
Aromatic & Fatty acids
31 Isolongifolene 19.59 C15H24 204 0.48 unknown
32 1,2,3,4,5,6,7,8-Octahydro-2-naphthol, 4-methylene-2,5,5-trimethyl- 24.79 C14H22O 206 0.25 unknown
33 2,4,6-Octatriene, 3,4-dimethyl- 9.23 C10H16 136 0.26 unknown
34 Hexadecanoic acid, ethyl ester 37.81 C18H36O2 284 0.30 unknown
35 Ethyl oleate 44.93 C20H38O2 310 0.20 unknown
Aromatic & Fatty acids 1.49
Quinones & Steroids
36 5-Hydroxy-2,2,6,6-tetramethyl-4-cyclohexene-1,3-dione 14.26 C10H14O3 182 1.04 unknown
37 Androst-1-en-3-one, 17-(acetyloxy)-4,5-epoxy-,(4β,5β,17β)- 50.33 C21H28O4 344 2.14 unknown
Quinones & Steroids 3.18
Other compounds
38 6-acetyl-2,2,4,4-tetramethylcyclohexane-1,3,5-trione 16.37 C12H16O4 224 1.59 unknown
39 2-Cyclopropene-1-carboxylic acid, 2-(1,1-dimethyl-5-oxohexyl)-, methyl ester 18.68 C13H20O3 224 0.31 unknown
40 2-Hydroxy-5-methoxybenzaldehyde, TMS derivative 19.16 C11H16O3Si 224 0.32 unknown
41 2,2,4-Trimethyl-4-trimethylsilylethynylcyclopentane-1,3-dione 21.01 C13H20O2Si 236 25.0 unknown
42 1-Ethyl-2,2,4a,7,7-pentamethyl-1,2,3,4,4a,5,6,7-octahydro[1,8]naphthyridine 22.96 C15H28N2 236 0.72 unknown
43 4a,6a-Dimethyl-2-oxo-1a,2,4a,4b,5,6,6a,7,8,9,9a,9b,10,11-tetradecahydrocyclopenta[7,8]phenanthro[1,10ab]oxiren-7-yl acetate pk2 51.49 C21H28O4 344 7.63 unknown
44 2-Amino-3-cyano-4-methyl-4,6-dipyridin-4-ylcyclohexa-1,5-dien-1,3-dicarboxylic acid, diethyl ester 61.33 C24H24N4O4 432 0.32 unknown
45 2,6,10,14,18,22-Tetracosahexaene,2,6,10,15,19,23-hexamethyl- 62.28 C30H50 410 0.76 unknown
Other compounds 36.65
Total 80.1
By LC/MS QTOF
Terpenoids
1 11-Keto-β-boswellic acid 16.22 C30H46O4 471 6.96 antimicrobial (Jaroš et al. 2022)
Terpenoids 6.96
Phenolics
2 Metaproterenol 13.34 C11H17NO3 212 5.33 unknown
Phenolics 5.33
Flavonoids
3 Leiocarposide 12.63 C27H34O16 653 2.41 antimicrobial (Toiu et al. 2019)
4 Peonidin cation 15.24 C16H13O6+ 301 1.03 antifungal (Chen et al. 2023)
Flavonoids 3.44
Coumarins, Alkaloid & Steroids
5 7-Methoxycoumarin 0.80 C10H8O3 177 2.11 antifungal (Chen et al. 2023)
6 Quinupramine 12.12 C21H24N2 305 1.04 antimicrobial (Caldara and Marmiroli 2018)
7 5β-Pregnan-3α,17,20β21-tetrol-11-one 12.20 C21H34O5 366 1.39 unknown
8 γ-Muricholic acid 15.28 C24H35D5O5 391 1.70 antibacterial (Watanabe et al. 2017)
9 5β-Androstane-3α,17β-diol 12.07 C19H32O2 275 1.33 unknown
Coumarins, Alkaloid & Steroids 7.57
Ethylene glycol
10 Nonaethylene glycol 0.81 C18H38O10 432 5.00 antimicrobial (Shukla et al. 2012)
11 Decaethylene glycol 0.81 C20H42O11 459 6.10 antimicrobial (Shukla et al. 2012)
Ethylene glycol 11.1
Vitamins
12 1,25-Dihydroxy vitamin D2 16.23 C27H44O3 411 2.07 PGPM (Buchala and Pythoud 1988)
Vitamins 2.07
Fatty acid
13 18-Carboxy dinor leukotriene B4 12.12 C18H26O6 321 3.53 unknown
14 16,16-Dimethylprostaglandin E2 12.23 C22H36O5 363 1.20 unknown
15 Tafluprost (free acid) 12.25 C22H28F2O5 411 8.59 unknown
Fatty acid 13.32
Other compounds
16 Etidocaine 12.05 C17H28N2O 277 2.05 unknown
17 N-Desethylamodiaquine 12.12 C18H18ClN3O 328 2.05 unknown
18 Nigerose 12.19 C12H22O11 365 5.49 PGPM (Ichimura et al. 2022)
19 Unoprostone isopropyl ester 12.33 C25H44O5 407 1.23 unknown
20 Glu-Ile 13.49 C11H20N2O5 261 5.21 PGPM (Qiu et al. 2020)
21 Cinnamic acid 15.24 C9H8O2 149 2.12 antifungal (Guo et al. 2020)
22 3β-Hydroxy-5-cholenoic acid 15.49 C24H38O3 357 7.98 unknown
23 Octamethylcyclotetrasiloxane 15.54 C8H24O4Si4 297 1.14 unknown
Other compounds 27.27
Total 77.06

zPGPM = Plant growth promoting metabolites.

As shown in Table 3, the analysis of the 95% EEMC by GC/MS revealed 41 components comprising 98.39% of the total extract composition, represented by 45.31% of terpenoids, 1.95% of phenolics, 0.32% of flavonoids, 8.85% of naphthalene and aromatics as well as 41.99% of other compounds. Of terpenoids containing 28 phytochemicals, phytol (14%) was the predominant component, followed by 10,10-dimethyl-2,6-dimethylenebicyclo[7.2.0]undecan-5β-ol (3.89%), caryophyllene epoxide (2.53%), aromadendrene epoxide (2.45%) and selin-6-en-4α-ol (2.12%). For phenolics, the compounds presented a number of components, such as ethyl α-d-glucopyranoside (1.66%) and 2-hydroxy-5-methoxybenzaldehyde, a TMS derivative (0.26%). In contrast, pinostrobin (0.32%) was the only component of flavonoids. The LC/MS analysis showed the presence of 18 chemicals comprising 97.1% of the total extract composition, represented by 9.17% of terpenoids, 19.49% of phenolics, 5.55% of flavonoids and naphthalene, 7.79% of steroids and benzofurans, 12.91% of fatty acids and glucosides, 6.63% of vitamins, 26.25% of ethylene glycol and 9.31% of other compounds. The main compounds of ethylene glycol were nonaethylene glycol (10.28%) and decaethylene glycol (10.42%). The phenolics namely, acetaminophen (9.9%), 3,5-di-tert-butyl-2-hydroxybenzaldehyde (6.81%) and 6-gingerol (2.75%) were detected. Meanwhile, terpenoids and vitamins each contained only one component namely, ingenol (9.17%) and R-lipoic acid (6.63%), respectively. Based on the 95% EEMC analysis, it was clearly shown that the highest diversity of terpenoids was found among the total identified phytochemical compounds. Our findings were in good agreement with earlier work (Al-Abd et al. 2015) showing that the major phytochemical groups in M. cajuputi were terpenoids, phenolics, flavonoids aromatics and fatty acids. Recently, Isah et al. (2023) compiled and summarized work showing that terpenoids, phenolics, and flavonoids were the major phytocompounds of the solvent extracts and essential oil of M. cajuputi.

Regarding 95% EECV, as shown in Table 4, its compositional variability was in line with those of the 95% EEMC case, showing the highest diversity of terpenoids. Based on GC/MS, the 95% EECV contained 45 intricate chemical compositions consisting of 80.1% of the total extract composition, represented by 30.04% of terpenoids [mainly 1,8-cineole (14%), α-phellandrene (2.04%), γ-sitosterol (1.91%) and L-α-terpineol (1.42%)], 3.47% of phenolics [2'-hydroxy-5'- methoxyacetophenone, 3-methylbutylether (1.7%) and 2,6-di-tert-butyl-4-hydroxy-4-methylcyclohexa-2,5-dien-1-one (1.77%)], 5.27% of flavonoids [prosogerin E (2.06%) and 4',7-di-O-methylnaringenin (1.79%)], 1.49% of aromatic and fatty acids, 3.18% quinones and steroids, including 36.65% of other compounds. Based on the LC/MS, the analysis revealed the presence of 23 phytochemicals comprising 77.06% of the total plant extract composition. A total phytochemical compounds were identified as 6.96% of terpenoids (11-keto-β-boswellic acid), 5.33% of phenolics (metaproterenol), 3.44% of flavonoids (leiocarposide and peonidin cation), 7.57% of the groups of coumarins, alkaloids and steroids, 11.1% of ethylene glycol, 2.07% of vitamins (1,25-dihydroxy vitamin D2), 13.32% of fatty acids (tafluprost, 18-carboxy dinor leukotriene B4, and 16,16-dimethylprostaglandin E2) along with 27.27% of other compounds (nigerose and glu-ile). Based on the 95% EECV analysis, our findings were in good agreement with those of the previous studies by Salem et al. (2017), Ahmad and Athar (2016) and de Oliveira et al. (2014), demonstrating the detection of terpenoids (1,8-cinole), phenolics and flavonoids in C. viminalis.

As shown in Tables 3 and 4, terpenoids were the main compounds in both the EEMC and EECV followed by phenolics, flavonoids and ethylene glycol. The known biological activities (such as antifungal, antibacterial and antiviral activities) of the phytochemical compounds identified in EECV and EEMC were cited and compiled in Tables 3 and 4. Regarding the antimicrobial activities, terpenoid compounds (mainly phytol, 1,8-cineole, α-terpinene, terpinene-4-ol and 11-Keto-β-boswellic acid) were documented to exert potent antifungal activity against Candida albicans (Tadtong et al. 2016), Aspergillus spp. (Morcia et al. 2012; Kim et al. 2018), Alternaria spp. (Morcia et al. 2012; Marei and Abdelgaleil 2018), Botrytis cinerea (Yusoff et al. 2020), Fusarium spp. (Morcia et al. 2012; Marei and Abdelgaleil 2018), Penicillium sp. (Morcia et al. 2012; Marei and Abdelgaleil 2018), and Rhizoctonia solani (Marei and Abdelgaleil 2018). The large amount of terpenoids found in the 95% EEMC (55%) from this analysis tended to support our earlier result regarding the antifungal activity of both plant extracts tested via poisoned food testing, showing the maximum potential inhibition effect of 95% EEMC. Interestingly, our phytochemical analysis also confirmed the presence of vitamin E, 1,25-dihydroxy vitamin D2, nigerose and glu-ile in 95% EECV, which were cited as plant-growth-promoting metabolites (Muñoz and Munné-Bosch 2019; Qiu et al. 2020; Ichimura et al. 2022). Hence, this likely supported the positive effect (such as plant-growth-promoting activity) of EECV on the growth of lettuce in our study found during the phytotoxicity assessment.

Evaluation of EEMC and EECV as an inducer on development of Alternaria leaf spot and induction of defense enzymes in lettuce grown in a hydroponic system

The EEMC effect

The indirect effect of 95% EEMC at 15,000 and 50,000 ppm against Alternaria leaf spot in lettuce using CRD with 3 replications revealed that the use of the highest concentration (50,000 ppm) of the extract and fungicide led to the complete inhibition of leaf spot at 3 DAI (Fig. 4). In addition, disease progress developed further in all treatments. However, the 2 tested concentrations of the extract as well as the fungicide treatment still significantly (p < 0.05) showed a strong inhibition effect at 5 DAI. At 7 DAI, a statistically significant difference (p < 0.05) in the severity of Alternaria leaf spot was noted among the treatments. Disease severity in the extract treatments was significantly reduced (p < 0.05) by 50–70% compared to an inoculated control, while only the fungicide treatment resulted in a 40% reduction. Importantly, the high concentration (50,000 ppm) significantly (p < 0.05) resulted in the greatest level of disease reduction in this regard. Moreover, the activities of the induced defense enzymes of β-1,3-glucanase, chitinase and peroxidase were monitored along with the disease severity levels at 1, 3, 5 and 7 DAI. When lettuce plants were infected with a pathogen, the enzymatic activities increased with time as the disease developed. On the first day after inoculation, the strongest activity of β-1,3-glucanase at a significant (p < 0.05) level was noted in the 95% EEMC treatments (15,000 and 50,000 ppm) compared to an inoculated control. At 7 DAI, the highest activity at a significant level (p < 0.05) was shown in the 95% EEMC treatments, followed by the inoculated and fungicide control treatment, while the lowest level of activity was recorded in the healthy control. The activities of the chitinase and peroxidase enzymes showed patterns identical to that of β-1,3-glucanase. At 7 DAI, the 95% EEMC treatments resulted in significantly higher activity (p < 0.05) of chitinase compared to the inoculated control and the fungicide treatment, while the highest activity of peroxidase at a significant level (p < 0.05) was also noted in the 95% EEMC treatments (Table 5). This result confirmed that the disease severity was related to the activities of the 3 induced defense enzymes. To be precise, the highest level of enzyme activity was noted in lettuce treated with 95% EEMC showing less severity of Alternaria leaf spot. This implied that 95% EEMC acted as a resistance inducer.

With regard to plant parameters at harvest (21 days old), the 95% EEMC and fungicide treatments showed the highest values of both parameters (SPAD value and yield), which were statistically different (p < 0.05) compared to the inoculated control but not significantly different (p < 0.05) from the healthy control.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-01/N0130430102/images/HST_43_01_02_F4.jpg
Fig. 4.

Effect of 95% ethanolic extract from Melaleuca cajuputi leaves (95% EEMC) on Alternaria leaf spot (at 7 DAI) and growth of lettuce in a hydroponic system (21 days old).

Table 5.

Activity of defense enzymes against Alternaria in lettuce treated with 95% EEMC

Treatment Activity of defense enzyme
β-1,3-Glucanase
(µmol glucose /g of fresh leaves)
Chitinase
(µmol GlcNAc/g of fresh leaves)
Peroxidase
(unit/ g of fresh leaves)
1 DAI 3 DAI 5 DAI 7 DAI 1 DAI 3 DAI 5 DAI 7 DAI 1 DAI 3 DAI 5 DAI 7 DAI
T1z 1.53 dy 3.53 d 3.60 d 3.46 d 5.50 d 5.07 d 5.97 d 5.63 e 3.38 e 4.90 e 6.52 c 8.44 c
T2 2.17 b 5.27 b 6.17 b 7.36 b 9.43 b 11.25 b 15.95 b 17.30 c 5.37 c 6.89 c 8.51 b 10.43 b
T3 2.20 c 4.63 c 5.20 c 6.20 c 8.63 c 9.17 c 11.03 c 11.33 d 4.70 d 6.22 d 7.85 b 9.76 bc
T4 2.55 a 8.62 a 7.87 a 11.66 a 13.49 a 15.29 a 19.23 a 20.24 b 7.50 b 9.02 b 10.65 a 12.56 a
T5 2.72 a 8.72 a 7.97 a 11.83 a 13.49 a 14.91 a 19.99 a 23.12 a 8.30 a 9.82 a 11.45 a 13.36 a

zT1 = Healthy control, T2 = Inoculated control, T3 = Chemical control + pathogen, T4 = 95% EEMC-15,000 ppm + pathogen, T5 = 95% EEMC-50,000 ppm + pathogen.

yValues are the means of 3 replicates. Values in each column within each enzyme followed by the same letter are not significantly different according to LSD (p > 0.05).

The EECV effect

The determination effect of 50% and 95% EECV at 15,000 and 50,000 ppm on disease development and plant defense enzyme induction using CRD with 3 replications revealed that all treatments except for that of the healthy control showed no significant difference with regard to disease severity compared to the inoculated control (at 3 DAI). At 5 DAI, the leaf spot progressed to lesions in all treatment cases, except at the highest concentrations of 50% and 95% EECV, which still showed static lesions. At 7 DAI, the highest concentration (50,000 ppm) of both EECV treatments led to the highest (p < 0.05) disease reduction (75%), followed by the lower concentration (15,000 ppm) and the fungicide control treatments in the range of 43.75–50%. Regarding the induced defense enzymes (Table 6), all presented a pattern similar to those in the 95% EEMC experiment; that is, the enzymatic activities increased over time, and higher levels of enzyme induction were observed in the lettuce treatments with the plant extracts (including the 50% EECV). At 7 DAI, the highest and significant (p < 0.05) enzymes activities of β-1,3-glucanase and chitinase were noted in all 4 EECV treatments compared to the fungicide treatment and the inoculated control. For peroxidase, the highest and significant activity (p < 0.05) was only found in the 95% EECV case at 50,000 ppm. Considering these results, there was a reduction in the severity of Alternaria leaf spot and an increase in defense-related enzymes in the 50% and 95% EECV-treated lettuce. This result was in line with the EEMC experiment implying that EECV acted as a resistance inducer as well.

Table 6.

Activity of defense enzymes against Alternaria in lettuce treated with 50% and 95% EECV

Treatment Activity of defense enzyme
β-1,3-Glucanase
(µmol glucose /g of fresh leaves)
Chitinase
(µmol GlcNAc/g of fresh leaves)
Peroxidase
(unit/ g of fresh leaves)
1 DAI 3 DAI 5 DAI 7 DAI 1 DAI 3 DAI 5 DAI 7 DAI 1 DAI 3 DAI 5 DAI 7 DAI
T1z 1.53 cy 3.53 d 3.60 c 3.46 d 5.50 c 5.07 c 5.97 c 5.63 c 3.33 c 4.98 e 5.48 e 6.45 e
T2 2.17 b 5.27 c 9.43 b 12.86 c 11.00 b 14.30 b 18.67 b 21.96 b 6.02 b 6.47 cd 6.83 d 7.45 d
T3 2.20 b 5.37 c 9.50 b 12.43 c 10.80 b 15.07 b 18.60 b 21.66 b 6.79 a 6.54 bc 7.53 c 7.99 cd
T4 3.30 a 8.87 b 11.20 a 16.26 ab 16.00 a 18.20 a 21.63 a 26.46 a 6.48 a 7.12 a 7.50 c 8.29 cd
T5 3.27 a 9.30 a 11.60 a 15.73 b 15.50 a 17.63 a 22.03 a 26.63 a 6.52 a 6.83 ab 7.84 b 8.68 bc
T6 3.30 a 9.37 a 11.67 a 16.93 a 15.93 a 17.73 a 21.67 a 26.23 a 6.37 a 6.74 bc 6.91 d 9.52 b
T7 3.47 a 9.47 a 11.83 a 16.2 ab 15.93 a 17.27 a 21.83 a 26.53 a 6.22 b 6.18 d 8.18 a 10.97 a

zT1 = Healthy control, T2 = Inoculated control, T3 = Chemical control, T4 = 50% EECV-15,000 ppm + pathogen, T5 = 50% EECV-50,000 ppm + pathogen, T6 = 95% EECV-15,000 ppm + pathogen, T7 = 95% EECV-50,000 ppm + pathogen.

yValues are the means of three replicates. Values in each column within each enzyme followed by the same letter are not significantly different according to LSD (p > 0.05).

For the plant growth parameters, the 50% and 95% EECV as well as the fungicide treatments gave statistically (p < 0.05) higher SPAD values, which were significantly different compared to the inoculated control but not significantly different from the healthy control (Fig. 5). Interestingly, low concentrations of 50% EECV, 95% EECV and the fungicide treatment gave significantly higher (p < 0.05) yields than that of the inoculated control. Besides, the highest concentration (50,000 ppm) of 50% and 95% EECV significantly (p < 0.05) led to the highest yields and strongest growth stimulation effects on lettuce (about 23.5 g/plant) compared to the other treatments (in the range of 16.04–19.36 g/plant).

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-01/N0130430102/images/HST_43_01_02_F5.jpg
Fig. 5.

Effects of 50% and 95% ethanolic extracts from Callistemon viminalis leaves (EECV) on Alternaria leaf spot (at 7 DAI) and growth of lettuce in a hydroponic system (21 days old).

Correlation of disease severity and plant defense enzymes

The correlation between disease severity and plant defense enzymes in lettuce due to the effects of the inducers (EEMC as well as EECV) was assessed at 3, 5 and 7 DAI, as presented in Fig. 6. Moderate to high correlations (r) of –0.766, –0.575 and –0.807 were found between defense-related enzymes of β-1,3-glucanase, chitinase and peroxidase with disease severity in lettuce treated with EEMC at 7 DAI. The corresponding simple regression equation also showed that the increased levels of defense-related enzymes played a negative role in reducing the disease severity. A similar observation of a moderate to high negative correlation (r = –0.631, –0.722 and –0.708) as well as the corresponding simple regression equation outcomes were also found between defense enzymes and disease severity in the EECV lettuce at 7 DAI.

https://cdn.apub.kr/journalsite/sites/kshs/2025-043-01/N0130430102/images/HST_43_01_02_F6.jpg
Fig. 6.

Correlation of disease severity with β-1,3-glucanase, chitinase and peroxidase activities in lettuce plants treated with EEMC and EECV as an inducer against A. brassicicola at 3, 5 and 7 DAI.

In the experiments here, EEMC and EECV significantly reduced Alternaria leaf spot disease, while significantly higher accumulations of the three enzymes were found in lettuce treated with both extracts. Furthermore, a moderate to high negative correlation was observed between disease severity and plant defense enzymes in lettuce treated with both extracts. These results were likely due to the induction of plant defense enzymes by the plant extracts (Yamunarani et al. 2004; Latha et al. 2009; Gupta et al. 2013; Franzener et al. 2018). These enzymes played a role in suppressing plant diseases, thereby contributing significantly to better overall health and resistance of the plants (Akila et al. 2011; Arzoo et al. 2012; Franzener et al. 2018; Gholamnezhad 2019). β-1,3-glucanase and chitinase sequentially hydrolyzed cell wall components, such as β-1,3-glucans and chitins (Yamunarani et al. 2004; Gupta et al. 2013; Prasannath 2017). Meanwhile, peroxidase was associated with various defense-related processes, including the hypersensitive reactions; lignin biosynthesis; and the cross-linking of phenolics, glycoproteins, and suberin as well as the production of phytoalexins in plants (Prasannath 2017). In addition, our results were in good agreement with the reports from other Myrtaceae plant extracts demonstrating that Corymbia citriodora aqueous extract reduced Fusarium wilt and increased soluble-protein-related β-1,3-glucanase, chitinase and peroxidase levels in tomatoes under greenhouse condition (Arzoo et al. 2012). While Franzener et al. (2018) reported that a water extract of Corymbia citriodora (Myrtaceae plant) reduced the disease severity of Colletotrichum lagenarium and induced 2 enzymes (peroxidase and β-1,3-glucanse) in cucumber, our findings suggested that 95% EEMC as well as 50% and 95% EECV could act as inducers by increasing plant defense enzymes in the plants. These potential plant extracts could be developed into botanical fungicides for the management of leaf spot disease in the near future.

Conclusion

Thai indigenous Myrtaceae plants were tested here as substitutes for chemical fungicides. The 95% ethanolic extracts derived from 4 Myrtaceae leaves, namely Callistemon viminalis (EECV), Melaleuca cajuputi (EEMC), Syzygium jambos (EESJ), and Syzygium malaccense (EESM) exhibited no phytotoxic effects on lettuce. Interestingly, a plant growth stimulation effect on lettuce was detected with the 95% EECV application. Notably, all concentrations (5,000, 15,000, 30,000 ppm) of 95% EEMC significantly demonstrated the highest inhibitory effect, ranging from 85% to 100% on the mycelial growth of A. brassicicola, followed by 95% EECV ranging from 40% to 63%. In the spore germination test, complete inhibition was observed with the application of 95% EEMC (5,000 to 50,000 ppm) and 95% EECV (10,000 to 50,000 ppm). Among the identified phytochemical compounds, terpenoids (such as phytol, 1,8-cineole, α-terpinene, terpinene-4-ol and 11-Keto-β-boswellic acid) were the major bioactive components of both extracts (about 37%–55%) followed by phenolics, flavonoids, ethylene glycols and vitamins. Furthermore, the applications of 95% EEMC, 95% EECV and 50% EECV as inducers reduced the severity of Alternaria leaf spot on lettuce by 50% to 75% but increased the levels of plant defense enzymes (β-1,3-glucanase, chitinase, and peroxidase). Our findings provide evidence of the potential use of EEMC and EECV for controlling Alternaria leaf spot disease in lettuce, which was likely due to their direct effect with the presence of phytochemicals responsible for antifungal activity and the plant-growth-stimulating effect as well as their indirect effects as inducer for plant defense enzymes. Therefore, these M. cajuputi and C. viminalis extracts could serve as alternative potential sources for the development of botanical fungicides in agriculture.

Acknowledgements

The authors are very grateful to the School of Agricultural Technology, King Mongkut’s Institute Technology Ladkrabang, Thailand, for the support provided with this work.

References

1

Ahmad K, Athar F (2016) Phytochemistry and pharmacology of Callistemon viminalis (Myrtaceae): A review. J Nat Prod 7:1-10. https://doi.org/10.2174/2210315507666161216100323

10.2174/2210315507666161216100323
2

Akila R, Rajendran L, Harish S, Saveetha K, Raguchander T, Samiyappan R (2011) Combined application of botanical formulations and biocontrol agents for the management of Fusarium oxysporum f. sp. cubense (Foc) causing Fusarium wilt in banana. BioControl 57:175-183. https://doi.org/10.1016/j.biocontrol.2011.02.010

10.1016/j.biocontrol.2011.02.010
3

Al-Abd NM, Mohamed Nor Z, Mansor M, Azhar F, Hasan MS, Kassim M (2015) Antioxidant, antibacterial activity, and phytochemical characterization of Melaleuca cajuputi extract. BMC Complement Altern Med 15:385. https://doi.org/10.1186/s12906-015-0914-y

10.1186/s12906-015-0914-y26497742PMC4619549
4

Alreshidi M, Noumi E, Bouslama L, Ceylan O, Veettil VN, Adnan M, Danciu C, Elkahoui S, Badraoui R, et al. (2020) Phytochemical screening, antibacterial, antifungal, antiviral, cytotoxic, and antiquorum-sensing properties of Teucrium polium L. aerial parts methanolic extract. Plants 9. https://doi.org/10.3390/plants9111418

10.3390/plants911141833114026PMC7690738
5

Arzoo K, Biswas SK, Rajik M (2012) Biochemical evidences of defence response in tomato against Fusarium wilt induced by plant extracts. Plant Pathol J 11:42-50. https://doi.org/10.3923/ppj.2012.42.50

10.3923/ppj.2012.42.50
6

Bali AS, Batish DR, Singh HP, Kaur S, Kohli RK (2017) Phytotoxicity and weed management potential of leaf extracts of Callistemon viminalis against the weeds of rice. Acta Physiol Plant 39:25. https://doi.org/10.1007/s11738-0162313-5

10.1007/s11738-016-2313-5
7

Barros FC, Sagata É, Ferreira LCdC, Juliatti FC (2010) Indução de resistência em plantas à fitopatógenos. Biosci J 26:231-239

8

Benoit F, Ceustermans N (1995) Horticultural aspects of ecological soilless growing methods. In, Ed 396. International Society for Horticultural Science (ISHS), Leuven, Belgium, pp 11-24. https://doi.org/10.17660/ActaHortic.1995.396.1

10.17660/ActaHortic.1995.396.1
9

Bharat CS, Praveen D (2016) Evaluation of in vitro antimicrobial potential and phytochemical analysis of spruce, cajeput and jamrosa essential oil against clinical isolates. Int J Green Pharm 10:27-32

10

Blagojević JD, Vukojević JB, Ivanović ŽS (2020) Occurrence and characterization of Alternaria species associated with leaf spot disease in rapeseed in Serbia. Plant Pathol 69:883-900. https://doi.org/10.1111/ppa.13168

10.1111/ppa.13168
11

Boller T, Mauch F (1988) Colorimetric assay for chitinase. In Methods in Enzymology, Vol 161. Academic Press, pp 430-435. https://doi.org/10.1016/0076-6879(88)61052-4

10.1016/0076-6879(88)61052-4
12

Bonaldo SM, Schwan-Estrada KRF, Stangarlin JR, Tessmann DJ, Scapim CA (2004) Fungitoxicity, phytoalexins elicitor activity and protection of cucumber against Colletotrichum lagenarium, by Eucalyptus citriodora aqueous extract. Fitopatol Bras 29:128-134. https://doi.org/10.1590/S0100-41582004000200002

10.1590/S0100-41582004000200002
13

Bouzada MLM, Fabri RL, Nogueira M, Konno TUP, Duarte GG, Scio E (2009) Antibacterial, cytotoxic and phytochemical screening of some traditional medicinal plants in Brazil. Pharm Biol 47:44-52. https://doi.org/10.1080/13880200802411771

10.1080/13880200802411771
14

Buchala A, Pythoud F (1988) Vitamin D and related compounds as plant growth substances. Physiol Plant 74:391-396

10.1111/j.1399-3054.1988.tb00648.x
15

Bulhões CC, Bonaldo SM, Santos BTd, Trento RA (2012) Produtos alternativos no controle de antracnose (Colletotrichum gloeosporioides), cladosporiose (Cladosporium herbarum) e bacteriose (Xanthomonas campestris pv. passiflorae) em maracujazeiro no norte demato grosso. Rev Ciências Exatas e da Terra e Ciências Agrárias 7:12-19

16

Caldara M, Marmiroli N (2018) Tricyclic antidepressants inhibit Candida albicans growth and biofilm formation. Int J Antimicrob Agents 52:500-505. https://doi.org/10.1016/j.ijantimicag.2018.06.023

10.1016/j.ijantimicag.2018.06.02329990546
17

Carevic T, Kostic M, Nikolic B, Stojkovic D, Sokovic M, Ivanov M (2022) Hesperetin-Between the ability to diminish mono- and polymicrobial biofilms and toxicity. Molecules 27:6806. https://doi.org/10.3390/molecules27206806

10.3390/molecules2720680636296398PMC9611592
18

Carmello CR, Cardoso JC (2018) Effects of plant extracts and sodium hypochlorite on lettuce germination and inhibition of Cercospora longissima in vitro. Sci Hortic 234:245-249. https://doi.org/10.1016/j.scienta.2018.02.056

10.1016/j.scienta.2018.02.056
19

Celoto MIB, Papa MdFS, Sacramento LVSd, Celoto FJ (2008) Atividade antifúngica de extratos de plantas a Colletotrichum gloeosporioides Acta Sci Agron 30:1-5. https://doi.org/10.4025/actasciagron.v30i1.1104

10.4025/actasciagron.v30i1.1104
20

Chen YZ, Wang SR, Li T, Zhang GC, Yang J (2023) Antifungal activity of 6-methylcoumarin against Valsa mali and its possible mechanism of action. J Fungi (Basel) 9:5. https://doi.org/10.3390/jof9010005

10.3390/jof901000536675826PMC9861068
21

Chung PY, Navaratnam P, Chung LY (2011) Synergistic antimicrobial activity between pentacyclic triterpenoids and antibiotics against Staphylococcus aureus strains. Ann Clin Microbiol Antimicrob 10:25. https://doi.org/10.1186/1476-0711-10-25

10.1186/1476-0711-10-2521658242PMC3127748
22

Cordeiro L, Figueiredo P, Souza H, Sousa A, Andrade-Júnior F, Medeiros D, Nóbrega J, Silva D, Martins E, et al. (2020) Terpinen-4-ol as an antibacterial and antibiofilm agent against Staphylococcus aureus. Int J Mol Sci 21:4531. https://doi.org/10.3390/ijms21124531

10.3390/ijms2112453132630600PMC7350221
23

Dai J, Hu Y, Si Q, Gu Y, Xiao Z, Ge Q, Sha R (2022) Antioxidant and hypoglycemic activity of sequentially extracted fractions from pingguoli pear fermentation broth and identification of bioactive compounds. Molecules 27:6077. https://doi.org/10.3390/molecules27186077

10.3390/molecules2718607736144810PMC9505173
24

Darshani P, Sen Sarma S, Srivastava AK, Baishya R, Kumar D (2022) Anti-viral triterpenes: A review. Phytochem Rev 21:1761-1842. https://doi.org/10.1007/s11101-022-09808-1

10.1007/s11101-022-09808-135283698PMC8896976
25

de Oliveira CM, Cardoso MdG, Figueiredo ACdS, de Carvalho MLM, Miranda CASFd, Marques Albuquerque LR, Lee Nelson D, Souza Gomes Md, Silva LF, et al. (2014) Chemical composition and allelopathic activity of the essential oil from Callistemon viminalis (Myrtaceae) blossoms on lettuce seedlings. Am J Plant Sci 5:3551-3557. https://doi.org/10.4236/ajps.2014.524371

10.4236/ajps.2014.524371
26

Dethoup T, Songkumarn P, Rueangrit S, Suesa-ard S, Kaewkrajay C (2018) Fungicidal activity of Thai medicinal plant extracts against Alternaria brassicicola causing black spot of Chinese kale. Eur J Plant Pathol 152:157-167. https://doi.org/10.1007/s10658-018-1460-5

10.1007/s10658-018-1460-5
27

Dethoup T, Songkumarn P, Sirirak T, Kijjoa A (2019) Fungicidal activity of Acorus calamus L. extracts against plant pathogenic fungi. Agric Nat Resour 53:527-532

28

Ding Y, Huffaker A, Kollner TG, Weckwerth P, Robert CAM, Spencer JL, Lipka AE, Schmelz EA (2017) Selinene volatiles are essential precursors for maize defense promoting fungal pathogen resistance. Plant Physiol 175:1455-1468. https://doi.org/10.1104/pp.17.00879

10.1104/pp.17.0087928931629PMC5664469
29

Dubale S, Kebebe D, Zeynudin A, Abdissa N, Suleman S (2023) Phytochemical screening and antimicrobial activity evaluation of selected medicinal plants in Ethiopia. J Exp Pharmacol 15:51-62. https://doi.org/10.2147/jep.S379805

10.2147/JEP.S37980536789235PMC9922502
30

Durgadevi R, Abirami G, Alexpandi R, Nandhini K, Kumar P, Prakash S, Veera Ravi A (2019) Explication of the potential of 2-Hydroxy-4-methoxybenzaldehyde in hampering uropathogenic Proteus mirabilis crystalline biofilm and virulence. Front Microbiol 10:2804. https://doi.org/10.3389/fmicb.2019.02804

10.3389/fmicb.2019.0280431921010PMC6914683
31

El-Hefny M, Ashmawy NA, Salem MZM, Salem AZM (2017) Antibacterial activities of the phytochemicals-characterized extracts of Callistemon viminalis, Eucalyptus camaldulensis and Conyza dioscoridis against the growth of some phytopathogenic bacteria. Microb Pathog 113:348356. https://doi.org/10.1016/j.micpath.2017.11.004

10.1016/j.micpath.2017.11.00429126952
32

Elkelish A, El-Mogy MM, Niedbala G, Piekutowska M, Atia MAM, Hamada MMA, Shahin M, Mukherjee S, El-Yazied AA, et al. (2021) Roles of exogenous alpha-lipoic acid and cysteine in mitigation of drought stress and restoration of grain quality in wheat. Plants (Basel) 10:2318. https://doi.org/10.3390/plants10112318

10.3390/plants1011231834834681PMC8619972
33

Faleiro JH, Gonçalves RC, dos Santos MNG, da Silva DP, Naves PLF, Malafaia G (2016) The chemical featuring, toxicity, and antimicrobial activity of Psidium cattleianum (Myrtaceae) leaves. New J Sci 2016:1-8. https://doi.org/10.1155/2016/7538613

10.1155/2016/7538613
34

Foudah AI, Alqarni MH, Alam A, Salkini MA, Alam P, Alkholifi FK, Yusufoglu HS (2021) Determination of chemical composition, in vitro and in silico evaluation of essential oil from leaves of Apium graveolens grown in Saudi Arabia. Molecules 26:7372. https://doi.org/10.3390/molecules26237372

10.3390/molecules2623737234885954PMC8659096
35

Franzener G, Schwan-Estrada KRF, Moura GS, Kuhn OJ, Stangarlin JR (2018) Induction of defense enzymes and control of anthracnose in cucumber by Corymbia citriodora aqueous extract. Summa Phytopathol 44:10-16. https://doi.org/10.1590/0100-5405/2218

10.1590/0100-5405/2218
36

Freitas TS, Xavier JDC, Pereira RLS, Rocha JE, Muniz DF, da Silva PT, da Hora JP, Dos Santos HS, Bandeira PN, et al. (2020) Direct antibacterial and antibiotic resistance modulatory activity of chalcones synthesized from the natural product 2-hydroxy-3,4,6-trimethoxyacetophenone. FEMS Microbiol Lett 367:1-5. https://doi.org/10.1093/femsle/fnaa124

10.1093/femsle/fnaa12432756951
37

Fu J, Gao Y, Xing X (2022) Preliminary study on phytochemical constituents and biological activities of essential oil from Myriactis nepalensis Less. Molecules 27:4631. https://doi.org/10.3390/molecules27144631

10.3390/molecules2714463135889501PMC9324352
38

Fujiwara M, Ijichi K, Tokuhisa K, Katsuura K, Shigeta S, Konno K, Wang GY, Uemura D, Yokota T, et al. (1996) Mechanism of selective inhibition of human immunodeficiency virus by ingenol triacetate. Antimicrob Agents Chemother 40:271-273. https://doi.org/10.1128/aac.40.1.271

10.1128/AAC.40.1.2718787923PMC163100
39

Gholamnezhad J (2019) Effect of plant extracts on activity of some defense enzymes of apple fruit in interaction with Botrytis cinerea. J Integr Agric 18:115-123. https://doi.org/10.1016/s2095-3119(18)62104-5

10.1016/S2095-3119(18)62104-5
40

Guo Y, Lv J, Zhao Q, Dong Y, Dong K (2020) Cinnamic acid increased the incidence of Fusarium wilt by increasing the pathogenicity of Fusarium oxysporum and reducing the physiological and biochemical resistance of faba bean, which was alleviated by intercropping with wheat. Front Plant Sci 11:608389. https://doi.org/10.3389/fpls.2020.608389

10.3389/fpls.2020.60838933381139PMC7767866
41

Gupta P, Ravi I, Sharma V (2013) Induction of β-1,3-glucanase and chitinase activity in the defense response of Eruca sativa plants against the fungal pathogen Alternaria brassicicola. J Plant Interact 8:155-161. https://doi.org/10.1080/17429145.2012.679705

10.1080/17429145.2012.679705
42

Gurjar MS, Ali S, Akhtar M, Singh KS (2012) Efficacy of plant extracts in plant disease management. Agric Sci 03:425-433. https://doi.org/10.4236/as.2012.33050

10.4236/as.2012.33050
43

Harborne JB (1998) Phytochemical methods: A guide to modern techniques of plant analysis, Ed 2. Chapmann and Hall Publishers, London, UK

44

Hassan M, Bala SZ, Bashir M, Waziri PM, Musa Adam R, Umar MA, Kini P (2022) LC-MS and GCMS profiling of different fractions of Ficus platyphylla stem bark ethanolic extract. J Anal Methods Chem 2022:6349332. https://doi.org/10.1155/2022/6349332

10.1155/2022/634933236569176PMC9771666
45

Horsfield A, Wicks T, Davies K, Wilson D, Paton S (2010) Effect of fungicide use strategies on the control of early blight (Alternaria solani) and potato yield. Australas Plant Pathol 39:368-375. https://doi.org/10.1071/AP09090

10.1071/AP09090
46

Hussein JH, Mohammed YH, Imad HH (2016) Study of chemical composition of Foeniculum vulgare using Fourier transform infrared spectrophotometer and gas chromatography - mass spectrometry. J Pharmacogn Phytother 8:60-89. https://doi.org/10.5897/jpp2015.0372

10.5897/JPP2015.0372
47

Ichimura K, Takada M, Ogawa K (2022) Effects of treatments with nigerosylmaltooligosaccharide, glucose and sucrose on the vase life of cut snapdragon flowers. Sci Hortic 291:110565. https://doi.org/10.1016/j.scienta.2021.110565

10.1016/j.scienta.2021.110565
48

Imatomi M, Novaes P, Matos AP, Gualtieri SCJ, Molinillo JMG, Lacret R, Varela RM, Macías FA (2013) Phytotoxic effect of bioactive compounds isolated from Myrcia tomentosa (Myrtaceae) leaves. Biochem Syst Ecol 46:29-35. https://doi.org/10.1016/j.bse.2012.09.005

10.1016/j.bse.2012.09.005
49

Iqbal E, Salim KA, Lim LBL (2015) Phytochemical screening, total phenolics and antioxidant activities of bark and leaf extracts of Goniothalamus velutinus (Airy Shaw) from Brunei Darussalam. J King Saud Univ Sci 27:224-232. https://doi.org/10.1016/j.jksus.2015.02.003

10.1016/j.jksus.2015.02.003
50

Isah M, Rosdi RA, Wan Abdul Wahab WNA, Abdulla H, Sul'ain MD, Ishak WRW (2023) Phytoconstituents and biological activities of Melaleuca cajuputi Powell: A scoping review. J Appl Pharm Sci 13:10-23. https://doi.org/10.7324/japs.2023.130102

10.7324/JAPS.2023.130102
51

İşcan G, Kirimer N, Demirci F, Demirci B, Noma Y, Başer KH (2012) Biotransformation of (-)-(R)-αphellandrene: antimicrobial activity of its major metabolite. Chem Biodivers 9:1525-1532. https://doi.org/10.1002/cbdv.201100283

10.1002/cbdv.20110028322899613
52

Isnaini I, Achmadiyah R, Awaeh G, Khatimah H, Yasmina A (2023) Antioxidant and antiproliferative activities of methanol extract from Melaleuca cajuputi subsp. Cumingiana [Turcz.] Fruit. Jurnal Berkala Ilmiah Sains dan Terapan Kimia 17:21. https://doi.org/10.20527/jstk.v17i1.13055

10.20527/jstk.v17i1.13055
53

Jantasorn A, Moungsrimuangdee B, Dethoup T (2016) In vitro antifungal activity evaluation of five plant extracts against five plant pathogenic fungi causing rice and economic crop diseases. J Biopest 9:1-7. https://doi.org/10.57182/jbiopestic.9.1.01-07

10.57182/jbiopestic.9.1.01-07
54

Jaroš P, Timkina E, Michailidu J, Maršík D, Kulišová M, Kolouchová I, Demnerová K (2022) Boswellic acids as effective antibacterial antibiofilm agents. Molecules 27:3795. https://doi.org/10.3390/molecules27123795

10.3390/molecules2712379535744925PMC9228269
55

Kamiya H, Haraguchi A, Mitarai H, Yuda A, Wada H, Shuxin W, Ziqing R, Weihao S, Wada N (2024) In vitro evaluation of the antimicrobial properties of terpinen-4-ol on apical periodontitis-associated bacteria. J Infect Chemother 30:306-314. https://doi.org/10.1016/j.jiac.2023.10.021

10.1016/j.jiac.2023.10.02137922985
56

Karimi S, Farzaneh F, Asnaashari S, Parina P, Sarvari Y, Hazrati S (2019) Phytochemical analysis and anti-microbial activity of some important medicinal plants from north-west of Iran. Iran J Pharm Res 18:1871-1883. https://doi.org/10.22037/ijpr.2019.1100817

57

Keereedach P, Hrimpeng K, Boonbumrung K (2020) Antifungal activity of Thai cajuput oil and its effect on efflux-pump gene expression in fluconazole-resistant Candida albicans clinical isolates. Int J Microbiol 2020:5989206. https://doi.org/10.1155/2020/5989206

10.1155/2020/598920633488720PMC7803126
58

Khan FA, Khan NM, Ahmad S, Nasruddin, Aziz R, Ullah I, Almehmadi M, Allahyani M, Alsaiari AA, et al. (2022) Phytochemical profiling, antioxidant, antimicrobial and cholinesterase inhibitory effects of essential oils isolated from the leaves of Artemisia scoparia and Artemisia absinthium. Pharmaceuticals (Basel) 15:1221. https://doi.org/10.3390/ph15101221

10.3390/ph1510122136297333PMC9607455
59

Kim HM, Kwon H, Kim K, Lee SE (2018) Antifungal and antiaflatoxigenic activities of 1,8-cineole and t-cinnamaldehyde on Aspergillus flavus. Appl Sci 8:1655. https://doi.org/10.3390/app8091655

10.3390/app8091655
60

Kim S, Lee H, Lee S, Yoon Y, Choi KH (2015) Antimicrobial action of oleanolic acid on Listeria monocytogenes, Enterococcus faecium, and Enterococcus faecalis. PLoS One 10:e0118800. https://doi.org/10.1371/journal.pone.0118800

10.1371/journal.pone.011880025756202PMC4355482
61

Kozłowska J, Potaniec B, Żarowska B, Anioł M (2017) Synthesis and biological activity of novel o-alkyl derivatives of naringenin and their oximes. Molecules 22:1485. https://doi.org/10.3390/molecules22091485

10.3390/molecules2209148528878189PMC6151618
62

Kunasakdakul K, Suwitchayanon P (2012) Antimicrobial activities of chili and black pepper extracts on pathogens of Chinese kale. CMU J Nat Sci 11:135-141

63

Latha P, Anand T, Ragupathi N, Prakasam V, Samiyappan R (2009) Antimicrobial activity of plant extracts and induction of systemic resistance in tomato plants by mixtures of PGPR strains and Zimmu leaf extract against Alternaria solani. Biological Control 50:85-93. https://doi.org/10.1016/j.biocontrol.2009.03.002

10.1016/j.biocontrol.2009.03.002
64

Mangoyi R, Midiwo J, Mukanganyama S (2015) Isolation and characterization of an antifungal compound 5-hydroxy-7,4'-dimethoxyflavone from Combretum zeyheri. BMC Complement Altern Med 15:405. https://doi.org/10.1186/s12906-015-0934-7

10.1186/s12906-015-0934-726573005PMC4647299
65

Marei GIK, Abdelgaleil SAM (2018) Antifungal potential and biochemical effects of monoterpenes and phenylpropenes on plant. Plant Protection Science 54:9-16. https://doi.org/10.17221/9/2017-pps

10.17221/9/2017-PPS
66

Marinas IC, Oprea E, Buleandra M, Badea IA, Tihauan BM, Marutescu L, Angheloiu M, Matei E, Chifiriuc MC (2021) Chemical composition, antipathogenic and cytotoxic activity of the essential oil extracted from Amorpha fruticosa fruits. Molecules 26:3146. https://doi.org/10.3390/molecules26113146

10.3390/molecules2611314634074063PMC8197342
67

Marliyana SD, Mujahidin D, Syah YM (2018) Pinostrobin derivatives from prenylationreaction and their antibacterial activity against clinical bacteria. Mater Sci Eng 349:012057. https://doi.org/10.1088/1757-899X/349/1/012057

10.1088/1757-899X/349/1/012057
68

Mohammadi A, Bahramikia S (2019) Molecular identification and genetic variation of Alternaria species isolated from tomatoes using ITS1 sequencing and inter simple sequence repeat methods. Curr Med Mycol 5:1-8. https://doi.org/10.18502/cmm.5.2.1154

10.18502/cmm.5.2.1154
69

Mohanty S, Cock IE (2010) Bioactivity of Syzygium jambos methanolic extracts: Antibacterial activity and toxicity. Pharmacognosy Res 2:4-9. https://doi.org/10.4103/0974-8490.60577

10.4103/0974-8490.6057721808530PMC3140127
70

Morcia C, Malnati M, Terzi V (2012) In vitro antifungal activity of terpinen-4-ol, eugenol, carvone, 1,8cineole (eucalyptol) and thymol against mycotoxigenic plant pathogens. Food Addit Contam Part A Chem Anal Control Expo Risk Assess 29:415-422. https://doi.org/10.1080/19440049.2011.643458

10.1080/19440049.2011.64345822257275
71

Mulyaningsih S, Sporer F, Reichling J, Wink M (2011) Antibacterial activity of essential oils from Eucalyptus and of selected components against multidrug-resistant bacterial pathogens. Pharm Biol 49:893-899. https://doi.org/10.3109/13880209.2011.553625

10.3109/13880209.2011.55362521591991
72

Muñoz P, Munné-Bosch S (2019) Vitamin E in plants: Biosynthesis, transport, and function. Trends in Plant Science 24:1040-1051. https://doi.org/10.1016/j.tplants.2019.08.006

10.1016/j.tplants.2019.08.00631606282
73

Murugan S, Devi P, Parameswari NK, Mani KR (2011) Antimicrobial activity of Syzygium jambos against selected human pathogens. Int J Pharm Pharm Sci 3:44-47

74

Naidoo Y, Channangihalli Thimmegowda CS, Kasim N, Nicholas A, Naidoo G (2014) Chemical composition and antimicrobial activity of the essential oil of Ocimum obovatum E. Mey. Ex Benth. (Lamiaceae). J Essential Oil Bearing Plants 17:142-147. https://doi.org/10.1080/0972060X.2014.884782

10.1080/0972060X.2014.884782
75

Noriega P, Ballesteros J, De la Cruz A, Veloz T (2020) Chemical composition and preliminary antimicrobial activity of the hydroxylated sesquiterpenes in the essential oil from Piper barbatum Kunth Leaves. Plants (Basel) 9:211. https://doi.org/10.3390/plants9020211

10.3390/plants902021132041311PMC7076699
76

O'Neill T (2019) Diseases of lettuce crops. AHDB Horticulture, Warwickshire, UK

77

Patel D, Desai S, Desai A, Dave D, Meshram D (2019) Phytochemical evaluation and in-vitro thrombolytic activity of hydro alcoholic extract of Syzygium malaccense leaves. J Pharmacogn Phytochem 8:39163918

78

Pattanamahakul P, Strange RN (1999) Identification and toxicity of Alternaria brassicicola, the causal agent of dark leaf spot disease of Brassica species grown in Thailand. Plant Pathology 48:749-755. https://doi.org/10.1046/j.1365-3059.1999.00406.x

10.1046/j.1365-3059.1999.00406.x
79

Pawar VC, Thaker VS (2007) Evaluation of the anti-Fusarium oxysporum f. sp cicer and anti-Alternaria porri effects of some essential oils. World J Microbiol Biotechnol 23:1099-1106. https://doi.org/10.1007/s11274-006-9339-6

10.1007/s11274-006-9339-6
80

Petpheng B, Mudtaleb B, Piboon W, Paichid N, Sangkharak K (2023) The extraction of phytol from Hydrilla verticillata using ultrasonic-assisted extraction (UAE), the analysis of antibacterial activity, and the utilization of residual extract for polyhydroxyalkanoate (PHA) production. Biomass Convers Biorefin https://doi.org/10.1007/s13399-023-04331-5

10.1007/s13399-023-04331-5
81

Pinto KMSP, de Melo AFR, Mondego JM, do Nascimento LC, Cortez M, Izabel Mendes Marques , Aires AAdC, dos Anjos Neto AP, Medeiros RLSd, Araujo JRG, et al. (2018) Plant extracts enhancers of defense response in ponkan mandarin Seedlings against Alternaria alternate f. spp. citri infection. Afr J Agric Res 13:650-656. https://doi.org/10.5897/ajar2018.13025

10.5897/AJAR2018.13025
82

Prasannath K (2017) Plant defense-related enzymes against pathogens: A review. AGRIEAST J Agric Sci 11:38. https://doi.org/10.4038/agrieast.v11i1.33

10.4038/agrieast.v11i1.33
83

Puig CG, Reigosa MJ, Valentão P, Andrade PB, Pedrol N (2018) Unravelling the bioherbicide potential of Eucalyptus globulus Labill: Biochemistry and effects of its aqueous extract. PLoS One 13:e0192872. https://doi.org/10.1371/journal.pone.0192872

10.1371/journal.pone.019287229438430PMC5811039
84

Qiu XM, Sun YY, Ye XY, Li ZG (2020) Signaling role of glutamate in plants. Front Plant Sci 10:1743. https://doi.org/10.3389/fpls.2019.01743

10.3389/fpls.2019.0174332063909PMC6999156
85

Rita dCPdS, Pedro VPG, Marcelo RdS, Oscar JS, Edvan AC, and CGB-L (2017) Phytotoxicity of extracts of Myrciaria dubia (Kunth) McVaugh bioprocessed in vegetable crop sensitive to allelochemicals. Afr J Plant Sci 11:244-251. https://doi.org/10.5897/ajps2016.1491

10.5897/AJPS2016.1491
86

Saha M, Bandyopadhyay PK (2020) In vivo and in vitro antimicrobial activity of phytol, a diterpene molecule, isolated and characterized from Adhatoda vasica Nees. (Acanthaceae), to control severe bacterial disease of ornamental fish, Carassius auratus, caused by Bacillus licheniformis PKBMS16. Microb Pathog 141:103977. https://doi.org/10.1016/j.micpath.2020.103977

10.1016/j.micpath.2020.10397731953226
87

Sakander H, Koteshwara AR, Akhilesh B (2015) Evaluation of antifungal potential of selected medicinal plants against human pathogenic fungi. Int J Green Pharmacy 9:110-117. https://doi.org/10.4103/0973-8258.155058

10.4103/0973-8258.155058
88

Salem MZM, El-Hefny M, Nasser RA, Ali HM, El-Shanhorey NA, Elansary HO (2017) Medicinal and biological values of Callistemon viminalis extracts: History, current situation and prospects. Asian Pac J Trop Med 10:229-237. https://doi.org/10.1016/j.apjtm.2017.03.015

10.1016/j.apjtm.2017.03.01528442106
89

Sangpueak R, Phansak P, Thumanu K, Siriwong S, Wongkaew S, Buensanteai N (2021) Effect of salicylic acid formulations on induced plant defense against cassava anthracnose disease. Plant Pathol J 37:356-364. https://doi.org/10.5423/PPJ.OA.02.2021.0015

10.5423/PPJ.OA.02.2021.001534365747PMC8357568
90

Scur MC, Pinto FG, Pandini JA, Costa WF, Leite CW, Temponi LG (2016) Antimicrobial and antioxidant activity of essential oil and different plant extracts of Psidium cattleianum Sabine. Braz J Biol 76:101-108. https://doi.org/10.1590/1519-6984.13714

10.1590/1519-6984.1371426871744
91

Selestino Neta MC, Vittorazzi C, Guimaraes AC, Martins JD, Fronza M, Endringer DC, Scherer R (2017) Effects of beta-caryophyllene and Murraya paniculata essential oil in the murine hepatoma cells and in the bacteria and fungi 24-h time-kill curve studies. Pharm Biol 55:190-197. https://doi.org/10.1080/13880209.2016.1254251

10.1080/13880209.2016.125425127927082PMC6130565
92

Selvaraj T, Ambalavanan S (2013) Induction of defense-related enzymes in anthurium by application of fungal and bacterial biocontrol agents against Colletotrichum gloeosporioides. Int J Curr Microbiol App Sci 2:661-670

93

Serban G, Stanasel O, Serban E, Bota S (2018) 2-Amino-1,3,4-thiadiazole as a potential scaffold for promising antimicrobial agents. Drug Des Devel Ther 12:1545-1566. https://doi.org/10.2147/DDDT.S155958

10.2147/DDDT.S15595829910602PMC5987787
94

Shamsudin NF, Ahmed QU, Mahmood S, Ali Shah SA, Khatib A, Mukhtar S, Alsharif MA, Parveen H, Zakaria ZA (2022) Antibacterial effects of flavonoids and their structure-activity relationship study: A comparative interpretation. Molecules 27:1149. https://doi.org/10.3390/molecules27041149

10.3390/molecules2704114935208939PMC8879123
95

Sharif ZM, Kamal AF, Jalil NJ (2019) Chemical composition of Melaleuca Cajuputi Powell. Int J Eng Adv Technol 9:3479-3483. https://doi.org/10.35940/ijeat.A2668.109119

10.35940/ijeat.A2668.109119
96

Shukla P, Walia S, Ahluwalia V, Parmar BS, Nair MG (2012) Activity of alkanediol alkanoates against pathogenic plant fungi Rhizoctonia solani and Sclerotium rolfsii. Nat Prod Commun 7:1219-1222

10.1177/1934578X1200700930
97

Siddique S, Mazhar S, Firdaus-e-Bareen, Parveen Z (2018) Chemical characterization, antioxidant and antimicrobial activities of essential oil from Melaleuca quinquenervia leaves. Indian J Exp Biol 56:686-693

98

Şimşek M, Duman R (2017) Investigation of effect of 1,8-cineole on antimicrobial activity of chlorhexidine gluconate. Pharmacognosy Res 9:234-237. https://doi.org/10.4103/0974-8490.210329

10.4103/0974-8490.21032928827963PMC5541478
99

Somnuek S, Jaenaksorn T, Laosinwattana C (2020) Effect of crude ethanolic extracts from bottle brush (Callistemon viminalis) against leaf spot fungi and their phytotoxicity on lettuce (Lactuca sativa L.). Curr Appl Sci Technol 20:1-14. https://doi.org/10.14456/cast.1477.1

100

Somnuek S, Thipmanee K, Jaenaksorn T (2021) In vitro effect of Callistemon viminalis and Melaleuca cajuputi ethanolic extracts as botanical fungicide and insecticide. Int J Agric Technol 17:2363-2374

101

Srikanth CV, Chakraborti AK, Bachhawat AK (2005) Acetaminophen toxicity and resistance in the yeast Saccharomyces cerevisiae. Microbiology (Reading) 151:99-111. https://doi.org/10.1099/mic.0.27374-0

10.1099/mic.0.27374-015632430
102

Subramaniam S, Keerthiraja M, Sivasubramanian A (2014) Synergistic antibacterial action of βsitosterol-d-glucopyranoside isolated from Desmostachya bipinnata leaves with antibiotics against common human pathogens. Rev Bras Farmacogn 24:44-50. https://doi.org/10.1590/0102695x20142413348

10.1590/0102-695X20142413348
103

Sukdee S (2023) Antifungal activity of plant extracts against Colletotrichum capsici causal agent of chili anthracnose. Rattanakosin J Sci Technol 5:1-8

104

Tadtong S, Puengseangdee C, Prasertthanawut S, Hongratanaworakit T (2016) Antimicrobial constituents and effects of blended eucalyptus, rosemary, patchouli, pine, and cajuput essential oils. Nat Prod Commun 11:267-270. https://doi.org/10.1177/1934578X1601100234

10.1177/1934578X1601100234
10

Tan J, Li Y, Hou DX, Wu S (2019) The effects and mechanisms of cyanidin-3-glucoside and its phenolic metabolites in maintaining intestinal integrity. Antioxidants (Basel) 8:479. https://doi.org/10.3390/antiox8100479

10.3390/antiox810047931614770PMC6826635
106

Teixeira MFF, Pinheiro DT, Junior HCS, Alves EC, Barros TTV, Freitas MAMd, Dias DCFdS (2018) Allelopathic influence of some fruit tree leaf extracts on germination and seedling development of different weeds and vegetable crops. Aust J Crop Sci 12:726-730. https://doi.org/10.21475/ajcs.18.12.05.PNE839

10.21475/ajcs.18.12.05.PNE839
107

Thanaboripat D (2011) Control of aflatoxins in agricultural products using plant extracts. KMITL Sci Technol J 11:35-42

108

Thanaboripat D, Sarutipaisan C, Puangtong C, Chatpongsatorn P, Suvatti Y, Sukonthamut S, Charoensettasilp S (2016) Effects of four essential oils on the growth of aflatoxin producing fungi. KMITL Sci Technol J 16:104-111

109

Thanaboripat D, Suvathi Y, Srilohasin P, Sripakdee S, Patthanawanitchai O, Charoensettasilp S (2007) Inhibitory effect of essential oils on the growth of Aspergillus flavus. KMITL Sci Technol J 7:1-7

110

Tiwari P, Kumar B, Kaur M, Kaur G, Kaur H (2011) Phytochemical screening and extraction: A review. Int Pharm Sci 1:98-106

111

Toiu A, Vlase L, Vodnar DC, Gheldiu AM, Oniga I (2019) Solidago graminifolia L. Salisb. (Asteraceae) as a valuable source of bioactive polyphenols: HPLC profile, in vitro antioxidant and antimicrobial potential. Molecules 24:2666. https://doi.org/10.3390/molecules24142666

10.3390/molecules2414266631340530PMC6680997
112

Tzortzakis N, Proestos C (2024) Natural products and essential oils biocidal activities and innovative applications. Molecules

113

Ukit U, Widiana A, Rahmawati E, Hasby RM (2019) Antibacterial activities test of cajuput leaf waste extract (Melaleuca cajuputi Powell) on pathogenic bacteria. J Phys Conf Ser 1402:033030. https://doi.org/10.1088/1742-6596/1402/3/033030

10.1088/1742-6596/1402/3/033030
114

Vasconcelos LC, Carrijo TT, Venancio AN, Alves TA, Tuler AC, Hollunder RK, Garbin ML, Menini L, Praca-Fontes MM (2022) Phytochemical screening and phytocytotoxic effects of the tropical Myrcia vittoriana (Myrtaceae). An Acad Bras Cienc 94:e20210820. https://doi.org/10.1590/00013765202220210820

10.1590/0001-376520222021082035857965
115

Verburg JG, Huynh QK (1991) Purification and characterization of an antifungal chitinase from Arabidopsis thaliana. Plant Physiol 95:450-455. https://doi.org/10.1104/pp.95.2.450

10.1104/pp.95.2.45016668004PMC1077551
116

Wamba BEN, Nayim P, Mbaveng AT, Voukeng IK, Dzotam JK, Ngalani OJT, Kuete V (2018) Syzygium jambos displayed antibacterial and antibiotic-modulating activities against resistant phenotypes. Evid Based Complement Alternat Med 2018:5124735. https://doi.org/10.1155/2018/5124735

10.1155/2018/512473529707033PMC5863293
117

Wang H, Huang Y, Wang J, Chen X, Wei K, Wang M, Shang S (2016) Activities of azoxystrobin and difenoconazole against Alternaria alternata and their control efficacy. Crop Protection 90:54-58. https://doi.org/10.1016/j.cropro.2016.08.022

10.1016/j.cropro.2016.08.022
118

War AR, Paulraj MG, War MY, Ignacimuthu S (2011) Role of salicylic acid in induction of plant defense system in chickpea (Cicer arietinum L.). Plant Signal Behav 6:1787-1792. https://doi.org/10.4161/psb.6.11.17685

10.4161/psb.6.11.1768522057329PMC3329353
119

Watanabe M, Fukiya S, Yokota A (2017) Comprehensive evaluation of the bactericidal activities of free bile acids in the large intestine of humans and rodents. J Lipid Res 58:1143-1152. https://doi.org/10.1194/jlr.M075143

10.1194/jlr.M07514328404640PMC5454512
120

Wu PH, Chang HX, Shen YM (2023) Effects of synthetic and environmentally friendly fungicides on powdery mildew management and the phyllosphere microbiome of cucumber. PLoS One 18:e0282809. https://doi.org/10.1371/journal.pone.0282809

10.1371/journal.pone.028280936888572PMC9994715
121

Xi KY, Xiong SJ, Li G, Guo CQ, Zhou J, Ma JW, Yin JL, Liu YQ, Zhu YX (2022) Antifungal activity of ginger rhizome extract against Fusarium solani. Horticulturae 8:983. https://doi.org/10.3390/horticulturae8110983

10.3390/horticulturae8110983
122

Xie Q, Li F, Fang L, Liu W, Gu C (2020) The antitumor efficacy of beta-elemene by changing tumor inflammatory environment and tumor microenvironment. Biomed Res Int 2020:6892961. https://doi.org/10.1155/2020/6892961

10.1155/2020/689296132149121PMC7054771
123

Yamunarani K, Jaganathan R, Bhaskaran R, Govindaraju P, Velazhahan R (2004) Induction of early blight resistance in tomato by Quercus infectoria gall extract in association with accumulation of phenolics and defense-related enzymes. Acta Physiol Plant 26:281-290. https://doi.org/10.1007/s11738-004-0018-7

10.1007/s11738-004-0018-7
124

Yang LN, He MH, Ouyang HB, Zhu W, Pan ZC, Sui QJ, Shang LP, Zhan J (2019) Cross-resistance of the pathogenic fungus Alternaria alternata to fungicides with different modes of action. BMC Microbiology 19:205. https://doi.org/10.1186/s12866-019-1574-8

10.1186/s12866-019-1574-831477005PMC6720428
125

Yusoff SF, Haron FF, Tengku Muda Mohamed M, Asib N, Sakimin SZ, Abu Kassim F, Ismail SI (2020) Antifungal activity and phytochemical screening of Vernonia amygdalina extract against Botrytis cinerea causing gray mold disease on tomato fruits. Biology (Basel) 9:286. https://doi.org/10.3390/biology9090286

10.3390/biology909028632932993PMC7563699
126

Zhao F, Wang P, Lucardi RD, Su Z, Li S (2020) Natural sources and bioactivities of 2,4-di-tertbutylphenol and its analogs. Toxins (Basel) 12:35. https://doi.org/10.3390/toxins12010035

10.3390/toxins1201003531935944PMC7020479
페이지 상단으로 이동하기